--- /dev/null
+python-pysam (0.8.0-1) UNRELEASED; urgency=medium
+
+ [ Charles Plessy ]
+ * Requires Python 2.7 or higher.
+
+ [ Andreas Tille ]
+ * New upstream version
+ * Link against htslib
+
+ -- Andreas Tille <tille@debian.org> Tue, 19 Aug 2014 21:26:37 +0200
+
+python-pysam (0.7.7-1) unstable; urgency=medium
+
+ * New upstream releases.
+ * Upstream source code moved to GitHub.
+ * Watch the Python Package Index since there are no relevant tags on GitHub.
+ * Added a git-buildpackage configuration file to mark its usage.
+ * Build-depend samtools (>= 0.1.19); this is needed for the regression tests
+ in Wheezy.
+ * debian/patches/offline-tests.patch: correction from a later release.
+
+ -- Charles Plessy <plessy@debian.org> Sat, 19 Apr 2014 14:17:42 +0900
+
+python-pysam (0.7.5-5) unstable; urgency=medium
+
+ * Add make to autopkgtest dependencies
+ Closes: #741274
+
+ -- Andreas Tille <tille@debian.org> Wed, 19 Mar 2014 13:30:15 +0100
+
+python-pysam (0.7.5-4) unstable; urgency=medium
+
+ * Fix autotest
+ Closes: #741274
+
+ -- Andreas Tille <tille@debian.org> Tue, 11 Mar 2014 20:08:15 +0100
+
+python-pysam (0.7.5-3) unstable; urgency=medium
+
+ * Do not install tests in world writable dir
+ Closes: #739575
+
+ -- Andreas Tille <tille@debian.org> Sat, 01 Mar 2014 23:40:21 +0100
+
+python-pysam (0.7.5-2) unstable; urgency=medium
+
+ * debian/rules: Set PYTHONPATH correctly using dh_python
+ (thanks to Piotr Ożarowski <piotr@debian.org> for the patch)
+ Closes: #739631
+
+ -- Andreas Tille <tille@debian.org> Thu, 20 Feb 2014 19:01:46 +0100
+
+python-pysam (0.7.5-1) unstable; urgency=low
+
+ * Initial release (Closes: #738665)
+
+ -- Andreas Tille <tille@debian.org> Fri, 07 Feb 2014 18:29:40 +0100
--- /dev/null
+Source: python-pysam
+Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
+Uploaders: Charles Plessy <plessy@debian.org>,
+ Andreas Tille <tille@debian.org>
+Section: python
+XS-Testsuite: autopkgtest
+Priority: optional
+Build-Depends: debhelper (>= 9),
+ dh-python,
+ python-all-dev,
+ python-setuptools,
+ cython,
+ dh-python3,
+ python3-all-dev,
+ python3-setuptools,
+ cython3,
+ zlib1g-dev,
+ samtools (>= 0.1.19),
+ libhts-dev
+Standards-Version: 3.9.6
+Vcs-Browser: http://anonscm.debian.org/gitweb/?p=debian-med/python-pysam.git
+Vcs-Git: git://anonscm.debian.org/debian-med/python-pysam.git
+Homepage: https://github.com/pysam-developers/pysam
+X-Python-Version: >= 2.7
+X-Python3-Version: >= 3.2
+
+Package: python-pysam
+Architecture: any
+Depends: ${shlibs:Depends},
+ ${misc:Depends},
+ ${python:Depends},
+Description: interface for the SAM/BAM sequence alignment and mapping format
+ Pysam is a Python module for reading and manipulating Samfiles. It's a
+ lightweight wrapper of the samtools C-API.
+
+Package: python3-pysam
+Architecture: any
+Depends: ${shlibs:Depends},
+ ${misc:Depends},
+ ${python3:Depends},
+Description: interface for the SAM/BAM sequence alignment and mapping format
+ Pysam is a Python module for reading and manipulating Samfiles. It's a
+ lightweight wrapper of the samtools C-API.
+
+
+Package: python-pysam-tests
+Architecture: all
+Priority: extra
+Enhances: python-pysam
+Depends: ${shlibs:Depends},
+ ${misc:Depends},
+ ${python:Depends},
+ python,
+ python-pysam,
+ python-pyrex
+Description: interface for the SAM/BAM sequence alignment and mapping format (test data)
+ Pysam is a Python module for reading and manipulating Samfiles. It's a
+ lightweight wrapper of the samtools C-API.
+ .
+ This package contains the data provided by upstream to run the pysam
+ test suite.
+
+Package: python3-pysam-tests
+Architecture: all
+Priority: extra
+Enhances: python3-pysam
+Depends: ${shlibs:Depends},
+ ${misc:Depends},
+ ${python3:Depends},
+ python3,
+ python3-pysam,
+ cython3
+Description: interface for the SAM/BAM sequence alignment and mapping format (test data)
+ Pysam is a Python module for reading and manipulating Samfiles. It's a
+ lightweight wrapper of the samtools C-API.
+ .
+ This package contains the data provided by upstream to run the pysam
+ test suite.
--- /dev/null
+Format: http://www.debian.org/doc/packaging-manuals/copyright-format/1.0/
+Upstream-Name: pysam
+Upstream-Contact: Andreas Heger <andreas.heger@gmail.com>
+Source: https://pypi.python.org/packages/source/p/pysam/pysam-0.7.7.tar.gz
+
+Files: *
+Copyright: 2008-2010 Genome Research Ltd.
+License: MIT
+
+Files: samtools/khash.h samtools/kseq.h
+Copyright: 2008-2011 by Attractive Chaos <attractor@live.co.uk>
+License: MIT
+
+Files: samtools/kprobaln.c.pysam.c samtools/kaln.c.pysam.c samtools/kaln.h samtools/kprobaln.h
+Copyright: 2003-2006, 2008-2010, by Heng Li <lh3lh3@live.co.uk>
+License: MIT
+
+Files: tabix/tabix.h
+Copyright: 2009 Genome Research Ltd (GRL), 2010 Broad Institute
+License: MIT
+
+Files: samtools/bcftools/bcf.h
+Copyright: 2010 Broad Institute
+License: MIT
+
+Files: samtools/bgzf.c.pysam.c samtools/bgzf.h tabix/bgzf.c.pysam.c tabix/bgzf.h samtools/knetfile.c.pysam.c
+Copyright: 2008 Broad Institute / Massachusetts Institute of Technology
+ 2010-2012 Attractive Chaos <attractor@live.co.uk>
+License: MIT
+
+Files: tabix/bgzip.c.pysam.c
+Copyright: 2008 Broad Institute / Massachusetts Institute of Technology
+License: MIT
+
+Files: samtools/razf.c.pysam.c samtools/razf.h
+Copyright: 2008 Jue Ruan <ruanjue@gmail.com>, Heng Li <lh3@sanger.ac.uk>
+License: BSDlike1
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ .
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+Files: samtools/win32/zconf.h samtools/win32/zlib.h
+Copyright: 1995-2005 Jean-loup Gailly <jloup@gzip.org> and Mark Adler <madler@alumni.caltech.edu>
+License: BSDlike2
+ This software is provided 'as-is', without any express or implied
+ warranty. In no event will the authors be held liable for any damages
+ arising from the use of this software.
+ .
+ Permission is granted to anyone to use this software for any purpose,
+ including commercial applications, and to alter it and redistribute it
+ freely, subject to the following restrictions:
+ .
+ 1. The origin of this software must not be misrepresented; you must not
+ claim that you wrote the original software. If you use this software
+ in a product, an acknowledgment in the product documentation would be
+ appreciated but is not required.
+ 2. Altered source versions must be plainly marked as such, and must not be
+ misrepresented as being the original software.
+ 3. This notice may not be removed or altered from any source distribution.
+Comment: These files are not used and could be stripped from the source
+
+Files: samtools/win32/xcurses.h
+Copyright: 2008 wmcbrine
+License: PublicDomain
+ This file is in public domain.
+Comment: These files are not used and could be stripped from the source
+
+Files: samtools/misc/md5.*
+Copyright: 1993 Colin Plumb
+License: PublicDomain
+ No copyright is claimed.
+ This code is in the public domain; do with it what you wish.
+
+License: MIT
+ Permission is hereby granted, free of charge, to any person obtaining a copy
+ of this software and associated documentation files (the "Software"), to deal
+ in the Software without restriction, including without limitation the rights
+ to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+ copies of the Software, and to permit persons to whom the Software is
+ furnished to do so, subject to the following conditions:
+ .
+ The above copyright notice and this permission notice shall be included in
+ all copies or substantial portions of the Software.
+ .
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+ THE SOFTWARE.
+
--- /dev/null
+# This source package is managed with git-buildpackage and pristine-tar.
+
+[DEFAULT]
+# use pristine-tar:
+pristine-tar = True
--- /dev/null
+Author: Olivier Sallou <olivier.sallou@irisa.fr>
+Last-Updated: Fri, 07 Feb 2014 18:29:40 +0100
+Description: Prevent downloading distribute_setup
+
+--- a/setup.py
++++ b/setup.py
+@@ -205,8 +205,8 @@ if len(sys.argv) == 2 and sys.argv[1] ==
+ try:
+ from setuptools import Extension, setup
+ except ImportError:
+- from ez_setup import use_setuptools
+- use_setuptools()
++ #from ez_setup import use_setuptools
++ #use_setuptools()
+ from setuptools import Extension, setup
+
+ #######################################################
--- /dev/null
+Author: Andreas Tille <tille@debian.org>
+Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100
+Description: Prevent tests makefile from deleting files which
+ are contained inside the upstream source
+
+--- a/tests/Makefile
++++ b/tests/Makefile
+@@ -47,6 +47,11 @@
+ samtools view -bS $< > $@
+
+ clean:
++ mkdir keep_bam_files
++ mv ex9_fail.bam ex9_nofail.bam example_btag.bam example_empty_header.bam issue100.bam tag_bug.bam test_unaligned.bam keep_bam_files
+ rm -fr *.bam *.bai *.fai *.pileup* \
+ *~ calDepth *.dSYM pysam_*.sam \
+ ex2.sam ex2.sam.gz ex1.sam
++ mv keep_bam_files/* .
++ rmdir keep_bam_files
++ rm -rf pysam_test_work/
--- /dev/null
+Author: Andreas Tille <tille@debian.org>
+Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100
+Description: Create a copy of the test suite script and remove those
+ tests that try to fetch files from network
+
+--- /dev/null
++++ b/tests/pysam_test_offline.py
+@@ -0,0 +1,1816 @@
++#!/usr/bin/env python
++'''unit testing code for pysam.
++
++Execute in the :file:`tests` directory as it requires the Makefile
++and data files located there.
++'''
++
++import pysam
++import unittest
++import os, re, sys
++import itertools
++import collections
++import subprocess
++import shutil
++import logging
++
++IS_PYTHON3 = sys.version_info[0] >= 3
++
++if IS_PYTHON3:
++ from itertools import zip_longest
++else:
++ from itertools import izip as zip_longest
++
++
++SAMTOOLS="samtools"
++WORKDIR="pysam_test_work"
++
++def checkBinaryEqual( filename1, filename2 ):
++ '''return true if the two files are binary equal.'''
++ if os.path.getsize( filename1 ) != os.path.getsize( filename2 ):
++ return False
++
++ infile1 = open(filename1, "rb")
++ infile2 = open(filename2, "rb")
++
++ def chariter( infile ):
++ while 1:
++ c = infile.read(1)
++ if c == b"": break
++ yield c
++
++ found = False
++ for c1,c2 in zip_longest( chariter( infile1), chariter( infile2) ):
++ if c1 != c2: break
++ else:
++ found = True
++
++ infile1.close()
++ infile2.close()
++ return found
++
++def runSamtools( cmd ):
++ '''run a samtools command'''
++
++ try:
++ retcode = subprocess.call(cmd, shell=True,
++ stderr = subprocess.PIPE)
++ if retcode < 0:
++ print("Child was terminated by signal", -retcode)
++ except OSError as e:
++ print("Execution failed:", e)
++
++def getSamtoolsVersion():
++ '''return samtools version'''
++
++ with subprocess.Popen(SAMTOOLS, shell=True, stderr=subprocess.PIPE).stderr as pipe:
++ lines = b"".join(pipe.readlines())
++
++ if IS_PYTHON3:
++ lines = lines.decode('ascii')
++ return re.search( "Version:\s+(\S+)", lines).groups()[0]
++
++class BinaryTest(unittest.TestCase):
++ '''test samtools command line commands and compare
++ against pysam commands.
++
++ Tests fail, if the output is not binary identical.
++ '''
++
++ first_time = True
++
++ # a dictionary of commands to test
++ # first entry: (samtools output file, samtools command)
++ # second entry: (pysam output file, (pysam function, pysam options) )
++ commands = \
++ {
++ "view" :
++ (
++ ("ex1.view", "view ex1.bam > ex1.view"),
++ ("pysam_ex1.view", (pysam.view, "ex1.bam" ) ),
++ ),
++ "view2" :
++ (
++ ("ex1.view", "view -bT ex1.fa -o ex1.view2 ex1.sam"),
++ # note that -o ex1.view2 throws exception.
++ ("pysam_ex1.view", (pysam.view, "-bT ex1.fa -oex1.view2 ex1.sam" ) ),
++ ),
++ "sort" :
++ (
++ ( "ex1.sort.bam", "sort ex1.bam ex1.sort" ),
++ ( "pysam_ex1.sort.bam", (pysam.sort, "ex1.bam pysam_ex1.sort" ) ),
++ ),
++ "mpileup" :
++ (
++ ("ex1.pileup", "mpileup ex1.bam > ex1.pileup" ),
++ ("pysam_ex1.mpileup", (pysam.mpileup, "ex1.bam" ) ),
++ ),
++ "depth" :
++ (
++ ("ex1.depth", "depth ex1.bam > ex1.depth" ),
++ ("pysam_ex1.depth", (pysam.depth, "ex1.bam" ) ),
++ ),
++ "faidx" :
++ (
++ ("ex1.fa.fai", "faidx ex1.fa"),
++ ("pysam_ex1.fa.fai", (pysam.faidx, "ex1.fa") ),
++ ),
++ "index":
++ (
++ ("ex1.bam.bai", "index ex1.bam" ),
++ ("pysam_ex1.bam.bai", (pysam.index, "pysam_ex1.bam" ) ),
++ ),
++ "idxstats" :
++ (
++ ("ex1.idxstats", "idxstats ex1.bam > ex1.idxstats" ),
++ ("pysam_ex1.idxstats", (pysam.idxstats, "pysam_ex1.bam" ) ),
++ ),
++ "fixmate" :
++ (
++ ("ex1.fixmate", "fixmate ex1.bam ex1.fixmate" ),
++ ("pysam_ex1.fixmate", (pysam.fixmate, "pysam_ex1.bam pysam_ex1.fixmate") ),
++ ),
++ "flagstat" :
++ (
++ ("ex1.flagstat", "flagstat ex1.bam > ex1.flagstat" ),
++ ("pysam_ex1.flagstat", (pysam.flagstat, "pysam_ex1.bam") ),
++ ),
++ "calmd" :
++ (
++ ("ex1.calmd", "calmd ex1.bam ex1.fa > ex1.calmd" ),
++ ("pysam_ex1.calmd", (pysam.calmd, "pysam_ex1.bam ex1.fa") ),
++ ),
++ "merge" :
++ (
++ ("ex1.merge", "merge -f ex1.merge ex1.bam ex1.bam" ),
++ # -f option does not work - following command will cause the subsequent
++ # command to fail
++ ("pysam_ex1.merge", (pysam.merge, "pysam_ex1.merge pysam_ex1.bam pysam_ex1.bam") ),
++ ),
++ "rmdup" :
++ (
++ ("ex1.rmdup", "rmdup ex1.bam ex1.rmdup" ),
++ ("pysam_ex1.rmdup", (pysam.rmdup, "pysam_ex1.bam pysam_ex1.rmdup" )),
++ ),
++ "reheader" :
++ (
++ ( "ex1.reheader", "reheader ex1.bam ex1.bam > ex1.reheader"),
++ ( "pysam_ex1.reheader", (pysam.reheader, "ex1.bam ex1.bam" ) ),
++ ),
++ "cat":
++ (
++ ( "ex1.cat", "cat ex1.bam ex1.bam > ex1.cat"),
++ ( "pysam_ex1.cat", (pysam.cat, "ex1.bam ex1.bam" ) ),
++ ),
++ "targetcut":
++ (
++ ("ex1.targetcut", "targetcut ex1.bam > ex1.targetcut" ),
++ ("pysam_ex1.targetcut", (pysam.targetcut, "pysam_ex1.bam") ),
++ ),
++ "phase":
++ (
++ ("ex1.phase", "phase ex1.bam > ex1.phase" ),
++ ("pysam_ex1.phase", (pysam.phase, "pysam_ex1.bam") ),
++ ),
++ "import" :
++ (
++ ("ex1.bam", "import ex1.fa.fai ex1.sam.gz ex1.bam" ),
++ ("pysam_ex1.bam", (pysam.samimport, "ex1.fa.fai ex1.sam.gz pysam_ex1.bam") ),
++ ),
++ "bam2fq":
++ (
++ ("ex1.bam2fq", "bam2fq ex1.bam > ex1.bam2fq" ),
++ ("pysam_ex1.bam2fq", (pysam.bam2fq, "pysam_ex1.bam") ),
++ ),
++ "pad2unpad":
++ (
++ ("ex2.unpad", "pad2unpad -T ex1.fa ex2.bam > ex2.unpad" ),
++ ("pysam_ex2.unpad", (pysam.pad2unpad, "-T ex1.fa ex2.bam") ),
++ ),
++ "bamshuf":
++ (
++ ("ex1.bamshuf.bam", "bamshuf ex1.bam ex1.bamshuf" ),
++ ("pysam_ex1.bamshuf.bam", (pysam.bamshuf, "ex1.bam pysam_ex1.bamshuf") ),
++ ),
++ "bedcov":
++ (
++ ("ex1.bedcov", "bedcov ex1.bed ex1.bam > ex1.bedcov" ),
++ ("pysam_ex1.bedcov", (pysam.bedcov, "ex1.bed ex1.bam") ),
++ ),
++ }
++
++ # some tests depend on others. The order specifies in which order
++ # the samtools commands are executed.
++ # The first three (faidx, import, index) need to be in that order,
++ # the rest is arbitrary.
++ order = ('faidx', 'import', 'index',
++ # 'pileup1', 'pileup2', deprecated
++ # 'glfview', deprecated
++ 'view', 'view2',
++ 'sort',
++ 'mpileup',
++ 'depth',
++ 'idxstats',
++ 'fixmate',
++ 'flagstat',
++ ## 'calmd',
++ 'merge',
++ 'rmdup',
++ 'reheader',
++ 'cat',
++ 'bedcov',
++ 'targetcut',
++ 'phase',
++ 'bamshuf',
++ 'bam2fq',
++ 'pad2unpad',
++ )
++
++ def setUp( self ):
++ '''setup tests.
++
++ For setup, all commands will be run before the first test is
++ executed. Individual tests will then just compare the output
++ files.
++ '''
++ if BinaryTest.first_time:
++
++ # remove previous files
++ if os.path.exists( WORKDIR ):
++ shutil.rmtree( WORKDIR )
++ pass
++
++ # copy the source files to WORKDIR
++ os.makedirs( WORKDIR )
++
++ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "pysam_ex1.fa" ) )
++ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "ex1.fa" ) )
++ shutil.copy( "ex1.sam.gz", os.path.join( WORKDIR, "ex1.sam.gz" ) )
++ shutil.copy( "ex1.sam", os.path.join( WORKDIR, "ex1.sam" ) )
++ shutil.copy( "ex2.bam", os.path.join( WORKDIR, "ex2.bam" ) )
++
++ # cd to workdir
++ savedir = os.getcwd()
++ os.chdir( WORKDIR )
++
++ for label in self.order:
++ # print ("command=", label)
++ command = self.commands[label]
++ # build samtools command and target and run
++ samtools_target, samtools_command = command[0]
++ runSamtools( " ".join( (SAMTOOLS, samtools_command )))
++
++ # get pysam command and run
++ try:
++ pysam_target, pysam_command = command[1]
++ except ValueError as msg:
++ raise ValueError( "error while setting up %s=%s: %s" %\
++ (label, command, msg) )
++
++ pysam_method, pysam_options = pysam_command
++ try:
++ output = pysam_method( *pysam_options.split(" "), raw=True)
++ except pysam.SamtoolsError as msg:
++ raise pysam.SamtoolsError( "error while executing %s: options=%s: msg=%s" %\
++ (label, pysam_options, msg) )
++
++
++ if ">" in samtools_command:
++ with open( pysam_target, "wb" ) as outfile:
++ if type(output) == list:
++ if IS_PYTHON3:
++ for line in output:
++ outfile.write( line.encode('ascii') )
++ else:
++ for line in output: outfile.write( line )
++ else:
++ outfile.write(output)
++
++ os.chdir( savedir )
++ BinaryTest.first_time = False
++
++ samtools_version = getSamtoolsVersion()
++
++
++ def _r( s ):
++ # patch - remove any of the alpha/beta suffixes, i.e., 0.1.12a -> 0.1.12
++ if s.count('-') > 0: s = s[0:s.find('-')]
++ return re.sub( "[^0-9.]", "", s )
++
++ if _r(samtools_version) != _r( pysam.__samtools_version__):
++ raise ValueError("versions of pysam/samtools and samtools differ: %s != %s" % \
++ (pysam.__samtools_version__,
++ samtools_version ))
++
++ def checkCommand( self, command ):
++ if command:
++ samtools_target, pysam_target = self.commands[command][0][0], self.commands[command][1][0]
++ samtools_target = os.path.join( WORKDIR, samtools_target )
++ pysam_target = os.path.join( WORKDIR, pysam_target )
++ self.assertTrue( checkBinaryEqual( samtools_target, pysam_target ),
++ "%s failed: files %s and %s are not the same" % (command, samtools_target, pysam_target) )
++
++ def testImport( self ):
++ self.checkCommand( "import" )
++
++ def testIndex( self ):
++ self.checkCommand( "index" )
++
++ def testSort( self ):
++ self.checkCommand( "sort" )
++
++ def testMpileup( self ):
++ self.checkCommand( "mpileup" )
++
++ def testDepth( self ):
++ self.checkCommand( "depth" )
++
++ def testIdxstats( self ):
++ self.checkCommand( "idxstats" )
++
++ def testFixmate( self ):
++ self.checkCommand( "fixmate" )
++
++ def testFlagstat( self ):
++ self.checkCommand( "flagstat" )
++
++ def testMerge( self ):
++ self.checkCommand( "merge" )
++
++ def testRmdup( self ):
++ self.checkCommand( "rmdup" )
++
++ def testReheader( self ):
++ self.checkCommand( "reheader" )
++
++ def testCat( self ):
++ self.checkCommand( "cat" )
++
++ def testTargetcut( self ):
++ self.checkCommand( "targetcut" )
++
++ def testPhase( self ):
++ self.checkCommand( "phase" )
++
++ def testBam2fq( self ):
++ self.checkCommand( "bam2fq" )
++
++ def testBedcov( self ):
++ self.checkCommand( "bedcov" )
++
++ def testBamshuf( self ):
++ self.checkCommand( "bamshuf" )
++
++ def testPad2Unpad( self ):
++ self.checkCommand( "pad2unpad" )
++
++ # def testPileup1( self ):
++ # self.checkCommand( "pileup1" )
++
++ # def testPileup2( self ):
++ # self.checkCommand( "pileup2" )
++
++ # deprecated
++ # def testGLFView( self ):
++ # self.checkCommand( "glfview" )
++
++ def testView( self ):
++ self.checkCommand( "view" )
++
++ def testEmptyIndex( self ):
++ self.assertRaises( IOError, pysam.index, "exdoesntexist.bam" )
++
++ def __del__(self):
++ if os.path.exists( WORKDIR ):
++ pass
++ # shutil.rmtree( WORKDIR )
++
++class IOTest(unittest.TestCase):
++ '''check if reading samfile and writing a samfile are consistent.'''
++
++ def checkEcho( self, input_filename,
++ reference_filename,
++ output_filename,
++ input_mode, output_mode, use_template = True ):
++ '''iterate through *input_filename* writing to *output_filename* and
++ comparing the output to *reference_filename*.
++
++ The files are opened according to the *input_mode* and *output_mode*.
++
++ If *use_template* is set, the header is copied from infile using the
++ template mechanism, otherwise target names and lengths are passed
++ explicitely.
++
++ '''
++
++ infile = pysam.Samfile( input_filename, input_mode )
++ if use_template:
++ outfile = pysam.Samfile( output_filename, output_mode, template = infile )
++ else:
++ outfile = pysam.Samfile( output_filename, output_mode,
++ referencenames = infile.references,
++ referencelengths = infile.lengths,
++ add_sq_text = False )
++
++ iter = infile.fetch()
++
++ for x in iter: outfile.write( x )
++ infile.close()
++ outfile.close()
++
++ self.assertTrue( checkBinaryEqual( reference_filename, output_filename),
++ "files %s and %s are not the same" % (reference_filename, output_filename) )
++
++
++ def testReadWriteBam( self ):
++
++ input_filename = "ex1.bam"
++ output_filename = "pysam_ex1.bam"
++ reference_filename = "ex1.bam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "rb", "wb" )
++
++ def testReadWriteBamWithTargetNames( self ):
++
++ input_filename = "ex1.bam"
++ output_filename = "pysam_ex1.bam"
++ reference_filename = "ex1.bam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "rb", "wb", use_template = False )
++
++ def testReadWriteSamWithHeader( self ):
++
++ input_filename = "ex2.sam"
++ output_filename = "pysam_ex2.sam"
++ reference_filename = "ex2.sam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "r", "wh" )
++
++ def testReadWriteSamWithoutHeader( self ):
++
++ input_filename = "ex2.sam"
++ output_filename = "pysam_ex2.sam"
++ reference_filename = "ex1.sam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "r", "w" )
++
++ def testReadSamWithoutTargetNames( self ):
++ '''see issue 104.'''
++ input_filename = "example_unmapped_reads_no_sq.sam"
++
++ # raise exception in default mode
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++ # raise exception if no SQ files
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++ check_header = True)
++
++ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False )
++ result = list(infile.fetch())
++
++ def testReadBamWithoutTargetNames( self ):
++ '''see issue 104.'''
++ input_filename = "example_unmapped_reads_no_sq.bam"
++
++ # raise exception in default mode
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++ # raise exception if no SQ files
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++ check_header = True)
++
++
++ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False )
++ result = list(infile.fetch( until_eof = True))
++
++ def testReadSamWithoutHeader( self ):
++ input_filename = "ex1.sam"
++ output_filename = "pysam_ex1.sam"
++ reference_filename = "ex1.sam"
++
++ # reading from a samfile without header is not implemented.
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++ check_header = False )
++
++ def testReadUnformattedFile( self ):
++ '''test reading from a file that is not bam/sam formatted'''
++ input_filename = "example.vcf40"
++
++ # bam - file raise error
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "rb" )
++
++ # sam - file error, but can't fetch
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++ check_header = False)
++
++ def testBAMWithoutAlignedReads( self ):
++ '''see issue 117'''
++ input_filename = "test_unaligned.bam"
++ samfile = pysam.Samfile( input_filename, "rb", check_sq = False )
++ samfile.fetch( until_eof = True )
++
++ def testBAMWithShortBAI( self ):
++ '''see issue 116'''
++ input_filename = "example_bai.bam"
++ samfile = pysam.Samfile( input_filename, "rb", check_sq = False )
++ samfile.fetch( 'chr2' )
++
++ def testFetchFromClosedFile( self ):
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ samfile.close()
++ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
++
++ def testClosedFile( self ):
++ '''test that access to a closed samfile raises ValueError.'''
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ samfile.close()
++ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
++ self.assertRaises( ValueError, samfile.pileup, 'chr1', 100, 120)
++ self.assertRaises( ValueError, samfile.getrname, 0 )
++ self.assertRaises( ValueError, samfile.tell )
++ self.assertRaises( ValueError, samfile.seek, 0 )
++ self.assertRaises( ValueError, getattr, samfile, "nreferences" )
++ self.assertRaises( ValueError, getattr, samfile, "references" )
++ self.assertRaises( ValueError, getattr, samfile, "lengths" )
++ self.assertRaises( ValueError, getattr, samfile, "text" )
++ self.assertRaises( ValueError, getattr, samfile, "header" )
++
++ # write on closed file
++ self.assertEqual( 0, samfile.write(None) )
++
++ def testAutoDetection( self ):
++ '''test if autodetection works.'''
++
++ samfile = pysam.Samfile( "ex3.sam" )
++ self.assertRaises( ValueError, samfile.fetch, 'chr1' )
++ samfile.close()
++
++ samfile = pysam.Samfile( "ex3.bam" )
++ samfile.fetch('chr1')
++ samfile.close()
++
++ def testReadingFromSamFileWithoutHeader( self ):
++ '''read from samfile without header.
++ '''
++ samfile = pysam.Samfile( "ex7.sam", check_header = False, check_sq = False )
++ self.assertRaises( NotImplementedError, samfile.__iter__ )
++
++ def testReadingFromFileWithoutIndex( self ):
++ '''read from bam file without index.'''
++
++ assert not os.path.exists( "ex2.bam.bai" )
++ samfile = pysam.Samfile( "ex2.bam", "rb" )
++ self.assertRaises( ValueError, samfile.fetch )
++ self.assertEqual( len(list( samfile.fetch(until_eof = True) )), 3270 )
++
++ def testReadingUniversalFileMode( self ):
++ '''read from samfile without header.
++ '''
++
++ input_filename = "ex2.sam"
++ output_filename = "pysam_ex2.sam"
++ reference_filename = "ex1.sam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "rU", "w" )
++
++class TestFloatTagBug( unittest.TestCase ):
++ '''see issue 71'''
++
++ def testFloatTagBug( self ):
++ '''a float tag before another exposed a parsing bug in bam_aux_get.
++
++ Fixed in 0.1.19
++ '''
++ samfile = pysam.Samfile("tag_bug.bam")
++ read = next(samfile.fetch(until_eof=True))
++ self.assertTrue( ('XC',1) in read.tags )
++ self.assertEqual(read.opt('XC'), 1)
++
++class TestLargeFieldBug( unittest.TestCase ):
++ '''see issue 100'''
++
++ def testLargeFileBug( self ):
++ '''when creating a read with a large entry in the tag field
++ causes an errror:
++ NotImplementedError: tags field too large
++ '''
++ samfile = pysam.Samfile("issue100.bam")
++ read = next(samfile.fetch(until_eof=True))
++ new_read = pysam.AlignedRead()
++ new_read.tags = read.tags
++ self.assertEqual( new_read.tags, read.tags )
++
++class TestTagParsing( unittest.TestCase ):
++ '''tests checking the accuracy of tag setting and retrieval.'''
++
++ def makeRead( self ):
++ a = pysam.AlignedRead()
++ a.qname = "read_12345"
++ a.tid = 0
++ a.seq="ACGT" * 3
++ a.flag = 0
++ a.rname = 0
++ a.pos = 1
++ a.mapq = 20
++ a.cigar = ( (0,10), (2,1), (0,25) )
++ a.mrnm = 0
++ a.mpos=200
++ a.isize = 0
++ a.qual ="1234" * 3
++ # todo: create tags
++ return a
++
++ def testNegativeIntegers( self ):
++ x = -2
++ aligned_read = self.makeRead()
++ aligned_read.tags = [("XD", int(x) ) ]
++ # print (aligned_read.tags)
++
++ def testNegativeIntegers2( self ):
++ x = -2
++ r = self.makeRead()
++ r.tags = [("XD", int(x) ) ]
++ outfile = pysam.Samfile( "test.bam",
++ "wb",
++ referencenames = ("chr1",),
++ referencelengths = (1000,) )
++ outfile.write (r )
++ outfile.close()
++
++ def testCigarString( self ):
++ r = self.makeRead()
++ self.assertEqual( r.cigarstring, "10M1D25M" )
++ r.cigarstring = "20M10D20M"
++ self.assertEqual( r.cigar, [(0,20), (2,10), (0,20)])
++
++ def testLongTags( self ):
++ '''see issue 115'''
++
++ r = self.makeRead()
++ rg = 'HS2000-899_199.L3'
++ tags = [('XC', 85), ('XT', 'M'), ('NM', 5), ('SM', 29), ('AM', 29), ('XM', 1), ('XO', 1), ('XG', 4), ('MD', '37^ACCC29T18'), ('XA','5,+11707,36M1I48M,2;21,-48119779,46M1I38M,2;hs37d5,-10060835,40M1D45M,3;5,+11508,36M1I48M,3;hs37d5,+6743812,36M1I48M,3;19,-59118894,46M1I38M,3;4,-191044002,6M1I78M,3;')]
++
++ r.tags = tags
++ r.tags += [("RG",rg)] * 100
++ tags += [("RG",rg)] * 100
++
++ self.assertEqual( tags, r.tags )
++
++class TestIteratorRow(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def checkRange( self, rnge ):
++ '''compare results from iterator with those from samtools.'''
++ ps = list(self.samfile.fetch(region=rnge))
++ sa = list(pysam.view( "ex1.bam", rnge, raw = True) )
++ self.assertEqual( len(ps), len(sa), "unequal number of results for range %s: %i != %i" % (rnge, len(ps), len(sa) ))
++ # check if the same reads are returned and in the same order
++ for line, (a, b) in enumerate( list(zip( ps, sa )) ):
++ d = b.split("\t")
++ self.assertEqual( a.qname, d[0], "line %i: read id mismatch: %s != %s" % (line, a.rname, d[0]) )
++ self.assertEqual( a.pos, int(d[3])-1, "line %i: read position mismatch: %s != %s, \n%s\n%s\n" % \
++ (line, a.pos, int(d[3])-1,
++ str(a), str(d) ) )
++ if sys.version_info[0] < 3:
++ qual = d[10]
++ else:
++ qual = d[10].encode('ascii')
++ self.assertEqual( a.qual, qual, "line %i: quality mismatch: %s != %s, \n%s\n%s\n" % \
++ (line, a.qual, qual,
++ str(a), str(d) ) )
++
++ def testIteratePerContig(self):
++ '''check random access per contig'''
++ for contig in self.samfile.references:
++ self.checkRange( contig )
++
++ def testIterateRanges(self):
++ '''check random access per range'''
++ for contig, length in zip(self.samfile.references, self.samfile.lengths):
++ for start in range( 1, length, 90):
++ self.checkRange( "%s:%i-%i" % (contig, start, start + 90) ) # this includes empty ranges
++
++ def tearDown(self):
++ self.samfile.close()
++
++
++class TestIteratorRowAll(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def testIterate(self):
++ '''compare results from iterator with those from samtools.'''
++ ps = list(self.samfile.fetch())
++ sa = list(pysam.view( "ex1.bam", raw = True) )
++ self.assertEqual( len(ps), len(sa), "unequal number of results: %i != %i" % (len(ps), len(sa) ))
++ # check if the same reads are returned
++ for line, pair in enumerate( list(zip( ps, sa )) ):
++ data = pair[1].split("\t")
++ self.assertEqual( pair[0].qname, data[0], "read id mismatch in line %i: %s != %s" % (line, pair[0].rname, data[0]) )
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestIteratorColumn(unittest.TestCase):
++ '''test iterator column against contents of ex4.bam.'''
++
++ # note that samfile contains 1-based coordinates
++ # 1D means deletion with respect to reference sequence
++ #
++ mCoverages = { 'chr1' : [ 0 ] * 20 + [1] * 36 + [0] * (100 - 20 -35 ),
++ 'chr2' : [ 0 ] * 20 + [1] * 35 + [0] * (100 - 20 -35 ),
++ }
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex4.bam","rb" )
++
++ def checkRange( self, contig, start = None, end = None, truncate = False ):
++ '''compare results from iterator with those from samtools.'''
++ # check if the same reads are returned and in the same order
++ for column in self.samfile.pileup(contig, start, end, truncate = truncate):
++ if truncate:
++ self.assertGreaterEqual( column.pos, start )
++ self.assertLess( column.pos, end )
++ thiscov = len(column.pileups)
++ refcov = self.mCoverages[self.samfile.getrname(column.tid)][column.pos]
++ self.assertEqual( thiscov, refcov, "wrong coverage at pos %s:%i %i should be %i" % (self.samfile.getrname(column.tid), column.pos, thiscov, refcov))
++
++ def testIterateAll(self):
++ '''check random access per contig'''
++ self.checkRange( None )
++
++ def testIteratePerContig(self):
++ '''check random access per contig'''
++ for contig in self.samfile.references:
++ self.checkRange( contig )
++
++ def testIterateRanges(self):
++ '''check random access per range'''
++ for contig, length in zip(self.samfile.references, self.samfile.lengths):
++ for start in range( 1, length, 90):
++ self.checkRange( contig, start, start + 90 ) # this includes empty ranges
++
++ def testInverse( self ):
++ '''test the inverse, is point-wise pileup accurate.'''
++ for contig, refseq in list(self.mCoverages.items()):
++ refcolumns = sum(refseq)
++ for pos, refcov in enumerate( refseq ):
++ columns = list(self.samfile.pileup( contig, pos, pos+1) )
++ if refcov == 0:
++ # if no read, no coverage
++ self.assertEqual( len(columns), refcov, "wrong number of pileup columns returned for position %s:%i, %i should be %i" %(contig,pos,len(columns), refcov) )
++ elif refcov == 1:
++ # one read, all columns of the read are returned
++ self.assertEqual( len(columns), refcolumns, "pileup incomplete at position %i: got %i, expected %i " %\
++ (pos, len(columns), refcolumns))
++
++ def testIterateTruncate( self ):
++ '''check random access per range'''
++ for contig, length in zip(self.samfile.references, self.samfile.lengths):
++ for start in range( 1, length, 90):
++ self.checkRange( contig, start, start + 90, truncate = True ) # this includes empty ranges
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestIteratorColumn2(unittest.TestCase):
++ '''test iterator column against contents of ex1.bam.'''
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def testStart( self ):
++ #print self.samfile.fetch().next().pos
++ #print self.samfile.pileup().next().pos
++ pass
++
++ def testTruncate( self ):
++ '''see issue 107.'''
++ # note that ranges in regions start from 1
++ p = self.samfile.pileup(region='chr1:170:172', truncate=True)
++ columns = [ x.pos for x in p ]
++ self.assertEqual( len(columns), 3)
++ self.assertEqual( columns, [169,170,171] )
++
++ p = self.samfile.pileup( 'chr1', 169, 172, truncate=True)
++ columns = [ x.pos for x in p ]
++
++ self.assertEqual( len(columns), 3)
++ self.assertEqual( columns, [169,170,171] )
++
++class TestAlignedReadFromBam(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex3.bam","rb" )
++ self.reads=list(self.samfile.fetch())
++
++ def testARqname(self):
++ self.assertEqual( self.reads[0].qname, "read_28833_29006_6945", "read name mismatch in read 1: %s != %s" % (self.reads[0].qname, "read_28833_29006_6945") )
++ self.assertEqual( self.reads[1].qname, "read_28701_28881_323b", "read name mismatch in read 2: %s != %s" % (self.reads[1].qname, "read_28701_28881_323b") )
++
++ def testARflag(self):
++ self.assertEqual( self.reads[0].flag, 99, "flag mismatch in read 1: %s != %s" % (self.reads[0].flag, 99) )
++ self.assertEqual( self.reads[1].flag, 147, "flag mismatch in read 2: %s != %s" % (self.reads[1].flag, 147) )
++
++ def testARrname(self):
++ self.assertEqual( self.reads[0].rname, 0, "chromosome/target id mismatch in read 1: %s != %s" % (self.reads[0].rname, 0) )
++ self.assertEqual( self.reads[1].rname, 1, "chromosome/target id mismatch in read 2: %s != %s" % (self.reads[1].rname, 1) )
++
++ def testARpos(self):
++ self.assertEqual( self.reads[0].pos, 33-1, "mapping position mismatch in read 1: %s != %s" % (self.reads[0].pos, 33-1) )
++ self.assertEqual( self.reads[1].pos, 88-1, "mapping position mismatch in read 2: %s != %s" % (self.reads[1].pos, 88-1) )
++
++ def testARmapq(self):
++ self.assertEqual( self.reads[0].mapq, 20, "mapping quality mismatch in read 1: %s != %s" % (self.reads[0].mapq, 20) )
++ self.assertEqual( self.reads[1].mapq, 30, "mapping quality mismatch in read 2: %s != %s" % (self.reads[1].mapq, 30) )
++
++ def testARcigar(self):
++ self.assertEqual( self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)], "read name length mismatch in read 1: %s != %s" % (self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)]) )
++ self.assertEqual( self.reads[1].cigar, [(0, 35)], "read name length mismatch in read 2: %s != %s" % (self.reads[1].cigar, [(0, 35)]) )
++
++ def testARcigarstring(self):
++ self.assertEqual( self.reads[0].cigarstring, '10M1D25M' )
++ self.assertEqual( self.reads[1].cigarstring, '35M' )
++
++ def testARmrnm(self):
++ self.assertEqual( self.reads[0].mrnm, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].mrnm, 0) )
++ self.assertEqual( self.reads[1].mrnm, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].mrnm, 1) )
++ self.assertEqual( self.reads[0].rnext, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].rnext, 0) )
++ self.assertEqual( self.reads[1].rnext, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].rnext, 1) )
++
++ def testARmpos(self):
++ self.assertEqual( self.reads[0].mpos, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].mpos, 200-1) )
++ self.assertEqual( self.reads[1].mpos, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].mpos, 500-1) )
++ self.assertEqual( self.reads[0].pnext, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].pnext, 200-1) )
++ self.assertEqual( self.reads[1].pnext, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].pnext, 500-1) )
++
++ def testARisize(self):
++ self.assertEqual( self.reads[0].isize, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].isize, 167) )
++ self.assertEqual( self.reads[1].isize, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].isize, 412) )
++ self.assertEqual( self.reads[0].tlen, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].tlen, 167) )
++ self.assertEqual( self.reads[1].tlen, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].tlen, 412) )
++
++ def testARseq(self):
++ self.assertEqual( self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 1: %s != %s" % (self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
++ self.assertEqual( self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "sequence size mismatch in read 2: %s != %s" % (self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") )
++ self.assertEqual( self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 4: %s != %s" % (self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
++
++ def testARqual(self):
++ self.assertEqual( self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 1: %s != %s" % (self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
++ self.assertEqual( self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "quality string mismatch in read 2: %s != %s" % (self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") )
++ self.assertEqual( self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 3: %s != %s" % (self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
++
++ def testARquery(self):
++ self.assertEqual( self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "query mismatch in read 1: %s != %s" % (self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
++ self.assertEqual( self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "query size mismatch in read 2: %s != %s" % (self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") )
++ self.assertEqual( self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT", "query mismatch in read 4: %s != %s" % (self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT") )
++
++ def testARqqual(self):
++ self.assertEqual( self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "qquality string mismatch in read 1: %s != %s" % (self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
++ self.assertEqual( self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "qquality string mismatch in read 2: %s != %s" % (self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") )
++ self.assertEqual( self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22", "qquality string mismatch in read 3: %s != %s" % (self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22") )
++
++ def testPresentOptionalFields(self):
++ self.assertEqual( self.reads[0].opt('NM'), 1, "optional field mismatch in read 1, NM: %s != %s" % (self.reads[0].opt('NM'), 1) )
++ self.assertEqual( self.reads[0].opt('RG'), 'L1', "optional field mismatch in read 1, RG: %s != %s" % (self.reads[0].opt('RG'), 'L1') )
++ self.assertEqual( self.reads[1].opt('RG'), 'L2', "optional field mismatch in read 2, RG: %s != %s" % (self.reads[1].opt('RG'), 'L2') )
++ self.assertEqual( self.reads[1].opt('MF'), 18, "optional field mismatch in read 2, MF: %s != %s" % (self.reads[1].opt('MF'), 18) )
++
++ def testPairedBools(self):
++ self.assertEqual( self.reads[0].is_paired, True, "is paired mismatch in read 1: %s != %s" % (self.reads[0].is_paired, True) )
++ self.assertEqual( self.reads[1].is_paired, True, "is paired mismatch in read 2: %s != %s" % (self.reads[1].is_paired, True) )
++ self.assertEqual( self.reads[0].is_proper_pair, True, "is proper pair mismatch in read 1: %s != %s" % (self.reads[0].is_proper_pair, True) )
++ self.assertEqual( self.reads[1].is_proper_pair, True, "is proper pair mismatch in read 2: %s != %s" % (self.reads[1].is_proper_pair, True) )
++
++ def testTags( self ):
++ self.assertEqual( self.reads[0].tags,
++ [('NM', 1), ('RG', 'L1'),
++ ('PG', 'P1'), ('XT', 'U')] )
++ self.assertEqual( self.reads[1].tags,
++ [('MF', 18), ('RG', 'L2'),
++ ('PG', 'P2'),('XT', 'R') ] )
++
++ def testOpt( self ):
++ self.assertEqual( self.reads[0].opt("XT"), "U" )
++ self.assertEqual( self.reads[1].opt("XT"), "R" )
++
++ def testMissingOpt( self ):
++ self.assertRaises( KeyError, self.reads[0].opt, "XP" )
++
++ def testEmptyOpt( self ):
++ self.assertRaises( KeyError, self.reads[2].opt, "XT" )
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestAlignedReadFromSam(TestAlignedReadFromBam):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex3.sam","r" )
++ self.reads=list(self.samfile.fetch())
++
++# needs to be implemented
++# class TestAlignedReadFromSamWithoutHeader(TestAlignedReadFromBam):
++#
++# def setUp(self):
++# self.samfile=pysam.Samfile( "ex7.sam","r" )
++# self.reads=list(self.samfile.fetch())
++
++class TestHeaderSam(unittest.TestCase):
++
++ header = {'SQ': [{'LN': 1575, 'SN': 'chr1'},
++ {'LN': 1584, 'SN': 'chr2'}],
++ 'RG': [{'LB': 'SC_1', 'ID': 'L1', 'SM': 'NA12891', 'PU': 'SC_1_10', "CN":"name:with:colon"},
++ {'LB': 'SC_2', 'ID': 'L2', 'SM': 'NA12891', 'PU': 'SC_2_12', "CN":"name:with:colon"}],
++ 'PG': [{'ID': 'P1', 'VN': '1.0'}, {'ID': 'P2', 'VN': '1.1'}],
++ 'HD': {'VN': '1.0'},
++ 'CO' : [ 'this is a comment', 'this is another comment'],
++ }
++
++ def compareHeaders( self, a, b ):
++ '''compare two headers a and b.'''
++ for ak,av in a.items():
++ self.assertTrue( ak in b, "key '%s' not in '%s' " % (ak,b) )
++ self.assertEqual( av, b[ak] )
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex3.sam","r" )
++
++ def testHeaders(self):
++ self.compareHeaders( self.header, self.samfile.header )
++ self.compareHeaders( self.samfile.header, self.header )
++
++ def testNameMapping( self ):
++ for x, y in enumerate( ("chr1", "chr2")):
++ tid = self.samfile.gettid( y )
++ ref = self.samfile.getrname( x )
++ self.assertEqual( tid, x )
++ self.assertEqual( ref, y )
++
++ self.assertEqual( self.samfile.gettid("chr?"), -1 )
++ self.assertRaises( ValueError, self.samfile.getrname, 2 )
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestHeaderBam(TestHeaderSam):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex3.bam","rb" )
++
++
++class TestHeader1000Genomes( unittest.TestCase ):
++
++ # bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase2b_alignment/data/NA07048/exome_alignment/NA07048.unmapped.ILLUMINA.bwa.CEU.exome.20120522_p2b.bam"
++ bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase3_EX_or_LC_only_alignment/data/HG00104/alignment/HG00104.chrom11.ILLUMINA.bwa.GBR.low_coverage.20130415.bam"
++
++ def testRead( self ):
++
++ # Skip fetching files from web when building the package
++ #f = pysam.Samfile( self.bamfile, "rb" )
++ #data = f.header.copy()
++ #self.assertTrue( data )
++ self.assertTrue( True )
++
++class TestUnmappedReads(unittest.TestCase):
++
++ def testSAM(self):
++ samfile=pysam.Samfile( "ex5.sam","r" )
++ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 )
++ samfile.close()
++
++ def testBAM(self):
++ samfile=pysam.Samfile( "ex5.bam","rb" )
++ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 )
++ samfile.close()
++
++class TestPileupObjects(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def testPileupColumn(self):
++ for pcolumn1 in self.samfile.pileup( region="chr1:105" ):
++ if pcolumn1.pos == 104:
++ self.assertEqual( pcolumn1.tid, 0, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn1.tid, 0) )
++ self.assertEqual( pcolumn1.pos, 105-1, "position mismatch in position 1: %s != %s" % (pcolumn1.pos, 105-1) )
++ self.assertEqual( pcolumn1.n, 2, "# reads mismatch in position 1: %s != %s" % (pcolumn1.n, 2) )
++ for pcolumn2 in self.samfile.pileup( region="chr2:1480" ):
++ if pcolumn2.pos == 1479:
++ self.assertEqual( pcolumn2.tid, 1, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn2.tid, 1) )
++ self.assertEqual( pcolumn2.pos, 1480-1, "position mismatch in position 1: %s != %s" % (pcolumn2.pos, 1480-1) )
++ self.assertEqual( pcolumn2.n, 12, "# reads mismatch in position 1: %s != %s" % (pcolumn2.n, 12) )
++
++ def testPileupRead(self):
++ for pcolumn1 in self.samfile.pileup( region="chr1:105" ):
++ if pcolumn1.pos == 104:
++ self.assertEqual( len(pcolumn1.pileups), 2, "# reads aligned to column mismatch in position 1: %s != %s" % (len(pcolumn1.pileups), 2) )
++# self.assertEqual( pcolumn1.pileups[0] # need to test additional properties here
++
++ def tearDown(self):
++ self.samfile.close()
++
++ def testIteratorOutOfScope( self ):
++ '''test if exception is raised if pileup col is accessed after iterator is exhausted.'''
++
++ for pileupcol in self.samfile.pileup():
++ pass
++
++ self.assertRaises( ValueError, getattr, pileupcol, "pileups" )
++
++class TestContextManager(unittest.TestCase):
++
++ def testManager( self ):
++ with pysam.Samfile('ex1.bam', 'rb') as samfile:
++ samfile.fetch()
++ self.assertEqual( samfile._isOpen(), False )
++
++class TestExceptions(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def testMissingFile(self):
++
++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "rb" )
++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "r" )
++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "r" )
++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "rb" )
++
++ def testBadContig(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr88" )
++
++ def testMeaninglessCrap(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "skljf" )
++
++ def testBackwardsOrderNewFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, 'chr1', 100, 10 )
++
++ def testBackwardsOrderOldFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:100-10")
++
++ def testOutOfRangeNegativeNewFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, -10 )
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, 0 )
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", -5, -10 )
++
++ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, -10 )
++ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, 0 )
++ self.assertRaises( ValueError, self.samfile.count, "chr1", -5, -10 )
++
++ def testOutOfRangeNegativeOldFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-10" )
++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-0" )
++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5--10" )
++
++ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-10" )
++ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-0" )
++ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5--10" )
++
++ def testOutOfRangNewFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999, 99999999999 )
++ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999, 99999999999 )
++
++ def testOutOfRangeLargeNewFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
++ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
++
++ def testOutOfRangeLargeOldFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1:99999999999999999-999999999999999999" )
++ self.assertRaises( ValueError, self.samfile.count, "chr1:99999999999999999-999999999999999999" )
++
++ def testZeroToZero(self):
++ '''see issue 44'''
++ self.assertEqual( len(list(self.samfile.fetch('chr1', 0, 0))), 0)
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestWrongFormat(unittest.TestCase):
++ '''test cases for opening files not in bam/sam format.'''
++
++ def testOpenSamAsBam( self ):
++ self.assertRaises( ValueError, pysam.Samfile, 'ex1.sam', 'rb' )
++
++ def testOpenBamAsSam( self ):
++ # test fails, needs to be implemented.
++ # sam.fetch() fails on reading, not on opening
++ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.bam', 'r' )
++ pass
++
++ def testOpenFastaAsSam( self ):
++ # test fails, needs to be implemented.
++ # sam.fetch() fails on reading, not on opening
++ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'r' )
++ pass
++
++ def testOpenFastaAsBam( self ):
++ self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'rb' )
++
++class TestFastaFile(unittest.TestCase):
++
++ mSequences = { 'chr1' :
++ b"CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCTGTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGGGGCTTAACCTCTGGTGACTGCCAGAGCTGCTGGCAAGCTAGAGTCCCATTTGGAGCCCCTCTAAGCCGTTCTATTTGTAATGAAAACTATATTTATGCTATTCAGTTCTAAATATAGAAATTGAAACAGCTGTGTTTAGTGCCTTTGTTCAACCCCCTTGCAACAACCTTGAGAACCCCAGGGAATTTGTCAATGTCAGGGAAGGAGCATTTTGTCAGTTACCAAATGTGTTTATTACCAGAGGGATGGAGGGAAGAGGGACGCTGAAGAACTTTGATGCCCTCTTCTTCCAAAGATGAAACGCGTAACTGCGCTCTCATTCACTCCAGCTCCCTGTCACCCAATGGACCTGTGATATCTGGATTCTGGGAAATTCTTCATCCTGGACCCTGAGAGATTCTGCAGCCCAGCTCCAGATTGCTTGTGGTCTGACAGGCTGCAACTGTGAGCCATCACAATGAACAACAGGAAGAAAAGGTCTTTCAAAAGGTGATGTGTGTTCTCATCAACCTCATACACACACATGGTTTAGGGGTATAATACCTCTACATGGCTGATTATGAAAACAATGTTCCCCAGATACCATCCCTGTCTTACTTCCAGCTCCCCAGAGGGAAAGCTTTCAACGCTTCTAGCCATTTCTTTTGGCATTTGCCTTCAGACCCTACACGAATGCGTCTCTACCACAGGGGGCTGCGCGGTTTCCCATCATGAAGCACTGAACTTCCACGTCTCATCTAGGGGAACAGGGAGGTGCACTAATGCGCTCCACGCCCAAGCCCTTCTCACAGTTTCTGCCCCCAGCATGGTTGTACTGGGCAATACATGAGATTATTAGGAAATGCTTTACTGTCATAACTATGAAGAGACTATTGCCAGATGAACCACACATTAATACTATGTTTCTTATCTGCACATTACTACCCTGCAATTAATATAATTGTGTCCATGTACACACGCTGTCCTATGTACTTATCATGACTCTATCCCAAATTCCCAATTACGTCCTATCTTCTTCTTAGGGAAGAACAGCTTAGGTATCAATTTGGTGTTCTGTGTAAAGTCTCAGGGAGCCGTCCGTGTCCTCCCATCTGGCCTCGTCCACACTGGTTCTCTTGAAAGCTTGGGCTGTAATGATGCCCCTTGGCCATCACCCAGTCCCTGCCCCATCTCTTGTAATCTCTCTCCTTTTTGCTGCATCCCTGTCTTCCTCTGTCTTGATTTACTTGTTGTTGGTTTTCTGTTTCTTTGTTTGATTTGGTGGAAGACATAATCCCACGCTTCCTATGGAAAGGTTGTTGGGAGATTTTTAATGATTCCTCAATGTTAAAATGTCTATTTTTGTCTTGACACCCAACTAATATTTGTCTGAGCAAAACAGTCTAGATGAGAGAGAACTTCCCTGGAGGTCTGATGGCGTTTCTCCCTCGTCTTCTTA",
++ 'chr2' :
++ b"TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAAGAAATTACAAAATATAGTTGAAAGCTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCTTATGAATTAACCCAGTCAGACAAAAATAAAGAAAAAAATTTTAAAAATGAACAGAGCTTTCAAGAAGTATGAGATTATGTAAAGTAACTGAACCTATGAGTCACAGGTATTCCTGAGGAAAAAGAAAAAGTGAGAAGTTTGGAAAAACTATTTGAGGAAGTAATTGGGGAAAACCTCTTTAGTCTTGCTAGAGATTTAGACATCTAAATGAAAGAGGCTCAAAGAATGCCAGGAAGATACATTGCAAGACAGACTTCATCAAGATATGTAGTCATCAGACTATCTAAAGTCAACATGAAGGAAAAAAATTCTAAAATCAGCAAGAGAAAAGCATACAGTCATCTATAAAGGAAATCCCATCAGAATAACAATGGGCTTCTCAGCAGAAACCTTACAAGCCAGAAGAGATTGGATCTAATTTTTGGACTTCTTAAAGAAAAAAAAACCTGTCAAACACGAATGTTATGCCCTGCTAAACTAAGCATCATAAATGAAGGGGAAATAAAGTCAAGTCTTTCCTGACAAGCAAATGCTAAGATAATTCATCATCACTAAACCAGTCCTATAAGAAATGCTCAAAAGAATTGTAAAAGTCAAAATTAAAGTTCAATACTCACCATCATAAATACACACAAAAGTACAAAACTCACAGGTTTTATAAAACAATTGAGACTACAGAGCAACTAGGTAAAAAATTAACATTACAACAGGAACAAAACCTCATATATCAATATTAACTTTGAATAAAAAGGGATTAAATTCCCCCACTTAAGAGATATAGATTGGCAGAACAGATTTAAAAACATGAACTAACTATATGCTGTTTACAAGAAACTCATTAATAAAGACATGAGTTCAGGTAAAGGGGTGGAAAAAGATGTTCTACGCAAACAGAAACCAAATGAGAGAAGGAGTAGCTATACTTATATCAGATAAAGCACACTTTAAATCAACAACAGTAAAATAAAACAAAGGAGGTCATCATACAATGATAAAAAGATCAATTCAGCAAGAAGATATAACCATCCTACTAAATACATATGCACCTAACACAAGACTACCCAGATTCATAAAACAAATACTACTAGACCTAAGAGGGATGAGAAATTACCTAATTGGTACAATGTACAATATTCTGATGATGGTTACACTAAAAGCCCATACTTTACTGCTACTCAATATATCCATGTAACAAATCTGCGCTTGTACTTCTAAATCTATAAAAAAATTAAAATTTAACAAAAGTAAATAAAACACATAGCTAAAACTAAAAAAGCAAAAACAAAAACTATGCTAAGTATTGGTAAAGATGTGGGGAAAAAAGTAAACTCTCAAATATTGCTAGTGGGAGTATAAATTGTTTTCCACTTTGGAAAACAATTTGGTAATTTCGTTTTTTTTTTTTTCTTTTCTCTTTTTTTTTTTTTTTTTTTTGCATGCCAGAAAAAAATATTTACAGTAACT",
++ }
++
++ def setUp(self):
++ self.file=pysam.Fastafile( "ex1.fa" )
++
++ def testFetch(self):
++ for id, seq in list(self.mSequences.items()):
++ self.assertEqual( seq, self.file.fetch( id ) )
++ for x in range( 0, len(seq), 10):
++ self.assertEqual( seq[x:x+10], self.file.fetch( id, x, x+10) )
++ # test x:end
++ self.assertEqual( seq[x:], self.file.fetch( id, x) )
++ # test 0:x
++ self.assertEqual( seq[:x], self.file.fetch( id, None, x) )
++
++
++ # unknown sequence returns ""
++ self.assertEqual( b"", self.file.fetch("chr12") )
++
++ def testOutOfRangeAccess( self ):
++ '''test out of range access.'''
++ # out of range access returns an empty string
++ for contig, s in self.mSequences.items():
++ self.assertEqual( self.file.fetch( contig, len(s), len(s)+1), b"" )
++
++ self.assertEqual( self.file.fetch( "chr3", 0 , 100), b"" )
++
++ def testFetchErrors( self ):
++ self.assertRaises( ValueError, self.file.fetch )
++ self.assertRaises( IndexError, self.file.fetch, "chr1", -1, 10 )
++ self.assertRaises( ValueError, self.file.fetch, "chr1", 20, 10 )
++
++ def testLength( self ):
++ self.assertEqual( len(self.file), 2 )
++
++ def tearDown(self):
++ self.file.close()
++
++class TestAlignedRead(unittest.TestCase):
++ '''tests to check if aligned read can be constructed
++ and manipulated.
++ '''
++
++ def checkFieldEqual( self, read1, read2, exclude = []):
++ '''check if two reads are equal by comparing each field.'''
++
++ for x in ("qname", "seq", "flag",
++ "rname", "pos", "mapq", "cigar",
++ "mrnm", "mpos", "isize", "qual",
++ "is_paired", "is_proper_pair",
++ "is_unmapped", "mate_is_unmapped",
++ "is_reverse", "mate_is_reverse",
++ "is_read1", "is_read2",
++ "is_secondary", "is_qcfail",
++ "is_duplicate", "bin"):
++ if x in exclude: continue
++ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" %
++ (x, getattr(read1, x), getattr(read2,x)))
++
++ def testEmpty( self ):
++ a = pysam.AlignedRead()
++ self.assertEqual( a.qname, None )
++ self.assertEqual( a.seq, None )
++ self.assertEqual( a.qual, None )
++ self.assertEqual( a.flag, 0 )
++ self.assertEqual( a.rname, 0 )
++ self.assertEqual( a.mapq, 0 )
++ self.assertEqual( a.cigar, None )
++ self.assertEqual( a.tags, [] )
++ self.assertEqual( a.mrnm, 0 )
++ self.assertEqual( a.mpos, 0 )
++ self.assertEqual( a.isize, 0 )
++
++ def buildRead( self ):
++ '''build an example read.'''
++
++ a = pysam.AlignedRead()
++ a.qname = "read_12345"
++ a.seq="ACGT" * 10
++ a.flag = 0
++ a.rname = 0
++ a.pos = 20
++ a.mapq = 20
++ a.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) )
++ a.mrnm = 0
++ a.mpos=200
++ a.isize=167
++ a.qual="1234" * 10
++ # todo: create tags
++ return a
++
++ def testUpdate( self ):
++ '''check if updating fields affects other variable length data
++ '''
++ a = self.buildRead()
++ b = self.buildRead()
++
++ # check qname
++ b.qname = "read_123"
++ self.checkFieldEqual( a, b, "qname" )
++ b.qname = "read_12345678"
++ self.checkFieldEqual( a, b, "qname" )
++ b.qname = "read_12345"
++ self.checkFieldEqual( a, b)
++
++ # check cigar
++ b.cigar = ( (0,10), )
++ self.checkFieldEqual( a, b, "cigar" )
++ b.cigar = ( (0,10), (2,1), (0,10) )
++ self.checkFieldEqual( a, b, "cigar" )
++ b.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) )
++ self.checkFieldEqual( a, b)
++
++ # check seq
++ b.seq = "ACGT"
++ self.checkFieldEqual( a, b, ("seq", "qual") )
++ b.seq = "ACGT" * 3
++ self.checkFieldEqual( a, b, ("seq", "qual") )
++ b.seq = "ACGT" * 10
++ self.checkFieldEqual( a, b, ("qual",))
++
++ # reset qual
++ b = self.buildRead()
++
++ # check flags:
++ for x in (
++ "is_paired", "is_proper_pair",
++ "is_unmapped", "mate_is_unmapped",
++ "is_reverse", "mate_is_reverse",
++ "is_read1", "is_read2",
++ "is_secondary", "is_qcfail",
++ "is_duplicate"):
++ setattr( b, x, True )
++ self.assertEqual( getattr(b, x), True )
++ self.checkFieldEqual( a, b, ("flag", x,) )
++ setattr( b, x, False )
++ self.assertEqual( getattr(b, x), False )
++ self.checkFieldEqual( a, b )
++
++ def testLargeRead( self ):
++ '''build an example read.'''
++
++ a = pysam.AlignedRead()
++ a.qname = "read_12345"
++ a.seq="ACGT" * 200
++ a.flag = 0
++ a.rname = 0
++ a.pos = 20
++ a.mapq = 20
++ a.cigar = ( (0, 4 * 200), )
++ a.mrnm = 0
++ a.mpos=200
++ a.isize=167
++ a.qual="1234" * 200
++
++ return a
++
++ def testTagParsing( self ):
++ '''test for tag parsing
++
++ see http://groups.google.com/group/pysam-user-group/browse_thread/thread/67ca204059ea465a
++ '''
++ samfile=pysam.Samfile( "ex8.bam","rb" )
++
++ for entry in samfile:
++ before = entry.tags
++ entry.tags = entry.tags
++ after = entry.tags
++ self.assertEqual( after, before )
++
++ def testUpdateTlen( self ):
++ '''check if updating tlen works'''
++ a = self.buildRead()
++ oldlen = a.tlen
++ oldlen *= 2
++ a.tlen = oldlen
++ self.assertEqual( a.tlen, oldlen )
++
++ def testPositions( self ):
++ a = self.buildRead()
++ self.assertEqual( a.positions,
++ [20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
++ 31, 32, 33, 34, 35, 36, 37, 38, 39,
++ 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
++ 50, 51, 52, 53, 54, 55, 56, 57, 58, 59] )
++
++ self.assertEqual( a.aligned_pairs,
++ [(0, 20), (1, 21), (2, 22), (3, 23), (4, 24),
++ (5, 25), (6, 26), (7, 27), (8, 28), (9, 29),
++ (None, 30),
++ (10, 31), (11, 32), (12, 33), (13, 34), (14, 35),
++ (15, 36), (16, 37), (17, 38), (18, 39), (19, None),
++ (20, 40), (21, 41), (22, 42), (23, 43), (24, 44),
++ (25, 45), (26, 46), (27, 47), (28, 48), (29, 49),
++ (30, 50), (31, 51), (32, 52), (33, 53), (34, 54),
++ (35, 55), (36, 56), (37, 57), (38, 58), (39, 59)] )
++
++ self.assertEqual( a.positions, [x[1] for x in a.aligned_pairs if x[0] != None and x[1] != None] )
++ # alen is the length of the aligned read in genome
++ self.assertEqual( a.alen, a.aligned_pairs[-1][0] + 1 )
++ # aend points to one beyond last aligned base in ref
++ self.assertEqual( a.positions[-1], a.aend - 1 )
++
++class TestDeNovoConstruction(unittest.TestCase):
++ '''check BAM/SAM file construction using ex6.sam
++
++ (note these are +1 coordinates):
++
++ read_28833_29006_6945 99 chr1 33 20 10M1D25M = 200 167 AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG <<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<< NM:i:1 RG:Z:L1
++ read_28701_28881_323b 147 chr2 88 30 35M = 500 412 ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA <<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<< MF:i:18 RG:Z:L2
++ '''
++
++ header = { 'HD': {'VN': '1.0'},
++ 'SQ': [{'LN': 1575, 'SN': 'chr1'},
++ {'LN': 1584, 'SN': 'chr2'}], }
++
++ bamfile = "ex6.bam"
++ samfile = "ex6.sam"
++
++ def checkFieldEqual( self, read1, read2, exclude = []):
++ '''check if two reads are equal by comparing each field.'''
++
++ for x in ("qname", "seq", "flag",
++ "rname", "pos", "mapq", "cigar",
++ "mrnm", "mpos", "isize", "qual",
++ "bin",
++ "is_paired", "is_proper_pair",
++ "is_unmapped", "mate_is_unmapped",
++ "is_reverse", "mate_is_reverse",
++ "is_read1", "is_read2",
++ "is_secondary", "is_qcfail",
++ "is_duplicate"):
++ if x in exclude: continue
++ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" %
++ (x, getattr(read1, x), getattr(read2,x)))
++
++ def setUp( self ):
++
++ a = pysam.AlignedRead()
++ a.qname = "read_28833_29006_6945"
++ a.seq="AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG"
++ a.flag = 99
++ a.rname = 0
++ a.pos = 32
++ a.mapq = 20
++ a.cigar = ( (0,10), (2,1), (0,25) )
++ a.mrnm = 0
++ a.mpos=199
++ a.isize=167
++ a.qual="<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<"
++ a.tags = ( ("NM", 1),
++ ("RG", "L1") )
++
++ b = pysam.AlignedRead()
++ b.qname = "read_28701_28881_323b"
++ b.seq="ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA"
++ b.flag = 147
++ b.rname = 1
++ b.pos = 87
++ b.mapq = 30
++ b.cigar = ( (0,35), )
++ b.mrnm = 1
++ b.mpos=499
++ b.isize=412
++ b.qual="<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<"
++ b.tags = ( ("MF", 18),
++ ("RG", "L2") )
++
++ self.reads = (a,b)
++
++ def testSAMWholeFile( self ):
++
++ tmpfilename = "tmp_%i.sam" % id(self)
++
++ outfile = pysam.Samfile( tmpfilename, "wh", header = self.header )
++
++ for x in self.reads: outfile.write( x )
++ outfile.close()
++ self.assertTrue( checkBinaryEqual( tmpfilename, self.samfile ),
++ "mismatch when construction SAM file, see %s %s" % (tmpfilename, self.samfile))
++
++ os.unlink( tmpfilename )
++
++ def testBAMPerRead( self ):
++ '''check if individual reads are binary equal.'''
++ infile = pysam.Samfile( self.bamfile, "rb")
++
++ others = list(infile)
++ for denovo, other in zip( others, self.reads):
++ self.checkFieldEqual( other, denovo )
++ self.assertEqual( other.compare( denovo ), 0 )
++
++ def testSAMPerRead( self ):
++ '''check if individual reads are binary equal.'''
++ infile = pysam.Samfile( self.samfile, "r")
++
++ others = list(infile)
++ for denovo, other in zip( others, self.reads):
++ self.checkFieldEqual( other, denovo )
++ self.assertEqual( other.compare( denovo), 0 )
++
++ def testBAMWholeFile( self ):
++
++ tmpfilename = "tmp_%i.bam" % id(self)
++
++ outfile = pysam.Samfile( tmpfilename, "wb", header = self.header )
++
++ for x in self.reads: outfile.write( x )
++ outfile.close()
++
++ self.assertTrue( checkBinaryEqual( tmpfilename, self.bamfile ),
++ "mismatch when construction BAM file, see %s %s" % (tmpfilename, self.bamfile))
++
++ os.unlink( tmpfilename )
++
++class TestDeNovoConstructionUserTags(TestDeNovoConstruction):
++ '''test de novo construction with a header that contains lower-case tags.'''
++
++ header = { 'HD': {'VN': '1.0'},
++ 'SQ': [{'LN': 1575, 'SN': 'chr1'},
++ {'LN': 1584, 'SN': 'chr2'}],
++ 'x1': {'A': 2, 'B': 5 },
++ 'x3': {'A': 6, 'B': 5 },
++ 'x2': {'A': 4, 'B': 5 } }
++
++ bamfile = "example_user_header.bam"
++ samfile = "example_user_header.sam"
++
++class TestEmptyHeader( unittest.TestCase ):
++ '''see issue 84.'''
++
++ def testEmptyHeader( self ):
++
++ s = pysam.Samfile('example_empty_header.bam')
++ self.assertEqual( s.header, {'SQ': [{'LN': 1000, 'SN': 'chr1'}]} )
++
++class TestBTagSam( unittest.TestCase ):
++ '''see issue 81.'''
++
++ compare = [ [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95],
++ [-100,200,-300,-400],
++ [-100,12],
++ [12,15],
++ [-1.0,5.0,2.5] ]
++
++ filename = 'example_btag.sam'
++
++ def testRead( self ):
++
++ s = pysam.Samfile(self.filename)
++ for x, read in enumerate(s):
++ if x == 0:
++ self.assertEqual( read.tags, [('RG', 'QW85I'), ('PG', 'tmap'), ('MD', '140'), ('NM', 0), ('AS', 140), ('FZ', [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95]), ('XA', 'map2-1'), ('XS', 53), ('XT', 38), ('XF', 1), ('XE', 0)]
++ )
++
++ fz = dict(read.tags)["FZ"]
++ self.assertEqual( fz, self.compare[x] )
++ self.assertEqual( read.opt("FZ"), self.compare[x])
++
++ def testWrite( self ):
++
++ s = pysam.Samfile(self.filename)
++ for read in s:
++ before = read.tags
++ read.tags = read.tags
++ after = read.tags
++ self.assertEqual( after, before )
++
++class TestBTagBam( TestBTagSam ):
++ filename = 'example_btag.bam'
++
++class TestDoubleFetch(unittest.TestCase):
++ '''check if two iterators on the same bamfile are independent.'''
++
++ def testDoubleFetch( self ):
++
++ samfile1 = pysam.Samfile('ex1.bam', 'rb')
++
++ for a,b in zip(samfile1.fetch(), samfile1.fetch()):
++ self.assertEqual( a.compare( b ), 0 )
++
++ def testDoubleFetchWithRegion( self ):
++
++ samfile1 = pysam.Samfile('ex1.bam', 'rb')
++ chr, start, stop = 'chr1', 200, 3000000
++ self.assertTrue(len(list(samfile1.fetch ( chr, start, stop))) > 0) #just making sure the test has something to catch
++
++ for a,b in zip(samfile1.fetch( chr, start, stop), samfile1.fetch( chr, start, stop)):
++ self.assertEqual( a.compare( b ), 0 )
++
++ def testDoubleFetchUntilEOF( self ):
++
++ samfile1 = pysam.Samfile('ex1.bam', 'rb')
++
++ for a,b in zip(samfile1.fetch( until_eof = True),
++ samfile1.fetch( until_eof = True )):
++ self.assertEqual( a.compare( b), 0 )
++
++class TestRemoteFileFTP(unittest.TestCase):
++ '''test remote access.
++
++ '''
++
++ # Need to find an ftp server without password on standard
++ # port.
++
++ url = "ftp://ftp.sanger.ac.uk/pub/rd/humanSequences/CV.bam"
++ region = "1:1-1000"
++
++ def testFTPView( self ):
++ return
++ result = pysam.view( self.url, self.region )
++ self.assertEqual( len(result), 36 )
++
++ def testFTPFetch( self ):
++ return
++ samfile = pysam.Samfile(self.url, "rb")
++ result = list(samfile.fetch( region = self.region ))
++ self.assertEqual( len(result), 36 )
++
++class TestLargeOptValues( unittest.TestCase ):
++
++ ints = ( 65536, 214748, 2147484, 2147483647 )
++ floats = ( 65536.0, 214748.0, 2147484.0 )
++
++ def check( self, samfile ):
++
++ i = samfile.fetch()
++ for exp in self.ints:
++ rr = next(i)
++ obs = rr.opt("ZP")
++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++ for exp in [ -x for x in self.ints ]:
++ rr = next(i)
++ obs = rr.opt("ZP")
++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++ for exp in self.floats:
++ rr = next(i)
++ obs = rr.opt("ZP")
++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++ for exp in [ -x for x in self.floats ]:
++ rr = next(i)
++ obs = rr.opt("ZP")
++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++ def testSAM( self ):
++ samfile = pysam.Samfile("ex10.sam", "r")
++ self.check( samfile )
++
++ def testBAM( self ):
++ samfile = pysam.Samfile("ex10.bam", "rb")
++ self.check( samfile )
++
++# class TestSNPCalls( unittest.TestCase ):
++# '''test pysam SNP calling ability.'''
++
++# def checkEqual( self, a, b ):
++# for x in ("reference_base",
++# "pos",
++# "genotype",
++# "consensus_quality",
++# "snp_quality",
++# "mapping_quality",
++# "coverage" ):
++# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" %
++# (x, getattr(a, x), getattr(b,x), str(a), str(b)))
++
++# def testAllPositionsViaIterator( self ):
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# try:
++# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base != "*"]
++# except pysam.SamtoolsError:
++# pass
++
++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++# calls = list(pysam.IteratorSNPCalls(i))
++# for x,y in zip( refs, calls ):
++# self.checkEqual( x, y )
++
++# def testPerPositionViaIterator( self ):
++# # test pileup for each position. This is a slow operation
++# # so this test is disabled
++# return
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
++# if x.reference_base == "*": continue
++# i = samfile.pileup( x.chromosome, x.pos, x.pos+1,
++# fastafile = fastafile,
++# stepper = "samtools" )
++# z = [ zz for zz in pysam.IteratorSamtools(i) if zz.pos == x.pos ]
++# self.assertEqual( len(z), 1 )
++# self.checkEqual( x, z[0] )
++
++# def testPerPositionViaCaller( self ):
++# # test pileup for each position. This is a fast operation
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++# caller = pysam.SNPCaller( i )
++
++# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
++# if x.reference_base == "*": continue
++# call = caller.call( x.chromosome, x.pos )
++# self.checkEqual( x, call )
++
++# class TestIndelCalls( unittest.TestCase ):
++# '''test pysam indel calling.'''
++
++# def checkEqual( self, a, b ):
++
++# for x in ("pos",
++# "genotype",
++# "consensus_quality",
++# "snp_quality",
++# "mapping_quality",
++# "coverage",
++# "first_allele",
++# "second_allele",
++# "reads_first",
++# "reads_second",
++# "reads_diff"):
++# if b.genotype == "*/*" and x == "second_allele":
++# # ignore test for second allele (positions chr2:439 and chr2:1512)
++# continue
++# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" %
++# (x, getattr(a, x), getattr(b,x), str(a), str(b)))
++
++# def testAllPositionsViaIterator( self ):
++
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# try:
++# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base == "*"]
++# except pysam.SamtoolsError:
++# pass
++
++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++# calls = [ x for x in list(pysam.IteratorIndelCalls(i)) if x != None ]
++# for x,y in zip( refs, calls ):
++# self.checkEqual( x, y )
++
++# def testPerPositionViaCaller( self ):
++# # test pileup for each position. This is a fast operation
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++# caller = pysam.IndelCaller( i )
++
++# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
++# if x.reference_base != "*": continue
++# call = caller.call( x.chromosome, x.pos )
++# self.checkEqual( x, call )
++
++class TestLogging( unittest.TestCase ):
++ '''test around bug issue 42,
++
++ failed in versions < 0.4
++ '''
++
++ def check( self, bamfile, log ):
++
++ if log:
++ logger = logging.getLogger('franklin')
++ logger.setLevel(logging.INFO)
++ formatter = logging.Formatter('%(asctime)s %(levelname)s %(message)s')
++ log_hand = logging.FileHandler('log.txt')
++ log_hand.setFormatter(formatter)
++ logger.addHandler(log_hand)
++
++ bam = pysam.Samfile(bamfile, 'rb')
++ cols = bam.pileup()
++ self.assertTrue( True )
++
++ def testFail1( self ):
++ self.check( "ex9_fail.bam", False )
++ self.check( "ex9_fail.bam", True )
++
++ def testNoFail1( self ):
++ self.check( "ex9_nofail.bam", False )
++ self.check( "ex9_nofail.bam", True )
++
++ def testNoFail2( self ):
++ self.check( "ex9_nofail.bam", True )
++ self.check( "ex9_nofail.bam", True )
++
++# TODOS
++# 1. finish testing all properties within pileup objects
++# 2. check exceptions and bad input problems (missing files, optional fields that aren't present, etc...)
++# 3. check: presence of sequence
++
++class TestSamfileUtilityFunctions( unittest.TestCase ):
++
++ def testCount( self ):
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++
++ for contig in ("chr1", "chr2" ):
++ for start in range( 0, 2000, 100 ):
++ end = start + 1
++ self.assertEqual( len( list( samfile.fetch( contig, start, end ) ) ),
++ samfile.count( contig, start, end ) )
++
++ # test empty intervals
++ self.assertEqual( len( list( samfile.fetch( contig, start, start ) ) ),
++ samfile.count( contig, start, start ) )
++
++ # test half empty intervals
++ self.assertEqual( len( list( samfile.fetch( contig, start ) ) ),
++ samfile.count( contig, start ) )
++
++ def testMate( self ):
++ '''test mate access.'''
++
++ with open( "ex1.sam", "rb" ) as inf:
++ readnames = [ x.split(b"\t")[0] for x in inf.readlines() ]
++ if sys.version_info[0] >= 3:
++ readnames = [ name.decode('ascii') for name in readnames ]
++
++ counts = collections.defaultdict( int )
++ for x in readnames: counts[x] += 1
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ for read in samfile.fetch():
++ if not read.is_paired:
++ self.assertRaises( ValueError, samfile.mate, read )
++ elif read.mate_is_unmapped:
++ self.assertRaises( ValueError, samfile.mate, read )
++ else:
++ if counts[read.qname] == 1:
++ self.assertRaises( ValueError, samfile.mate, read )
++ else:
++ mate = samfile.mate( read )
++ self.assertEqual( read.qname, mate.qname )
++ self.assertEqual( read.is_read1, mate.is_read2 )
++ self.assertEqual( read.is_read2, mate.is_read1 )
++ self.assertEqual( read.pos, mate.mpos )
++ self.assertEqual( read.mpos, mate.pos )
++
++ def testIndexStats( self ):
++ '''test if total number of mapped/unmapped reads is correct.'''
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ self.assertEqual( samfile.mapped, 3235 )
++ self.assertEqual( samfile.unmapped, 35 )
++
++class TestSamtoolsProxy( unittest.TestCase ):
++ '''tests for sanity checking access to samtools functions.'''
++
++ def testIndex( self ):
++ self.assertRaises( IOError, pysam.index, "missing_file" )
++
++ def testView( self ):
++ # note that view still echos "open: No such file or directory"
++ self.assertRaises( pysam.SamtoolsError, pysam.view, "missing_file" )
++
++ def testSort( self ):
++ self.assertRaises( pysam.SamtoolsError, pysam.sort, "missing_file" )
++
++class TestSamfileIndex( unittest.TestCase):
++
++ def testIndex( self ):
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ index = pysam.IndexedReads( samfile )
++ index.build()
++
++ reads = collections.defaultdict( int )
++
++ for read in samfile: reads[read.qname] += 1
++
++ for qname, counts in reads.items():
++ found = list(index.find( qname ))
++ self.assertEqual( len(found), counts )
++ for x in found: self.assertEqual( x.qname, qname )
++
++
++if __name__ == "__main__":
++ # build data files
++ print ("building data files")
++ subprocess.call( "make", shell=True)
++ print ("starting tests")
++ unittest.main()
++ print ("completed tests")
--- /dev/null
+# fix_cleanup_tests.patch
+do_not_use_distribute_setup.patch
+# offline-tests.patch
+use_external_htslib.patch
--- /dev/null
+Author: Andreas Tille <tille@debian.org>
+Date: Tue, 19 Aug 2014 21:26:37 +0200
+Description: setup.py allows to use external htslib which we do hereby
+
+--- a/setup.py
++++ b/setup.py
+@@ -32,7 +32,7 @@ IS_PYTHON3 = sys.version_info[0] >= 3
+ # pysam.
+ # external: use shared libhts.so compiled outside of
+ # pysam
+-HTSLIB = "separate"
++HTSLIB = "external"
+ HTSLIB_DIR = []
+
+ # collect pysam version
+@@ -55,6 +55,7 @@ tabix_dest = os.path.abspath("tabix")
+ if HTSLIB == 'external':
+ htslib_sources = []
+ chtslib_sources = []
++ shared_htslib_sources = htslib_sources
+ htslib_library_dirs = HTSLIB_DIR
+ htslib_libraries = ['hts']
+ elif HTSLIB == 'separate':
--- /dev/null
+Author: Olivier Sallou <olivier.sallou@irisa.fr>
+Last-Updated: Fri, 07 Feb 2014 18:29:40 +0100
+Description: Prevent downloading distribute_setup
+
+--- a/setup.py
++++ b/setup.py
+@@ -205,8 +205,8 @@ if len(sys.argv) == 2 and sys.argv[1] ==
+ try:
+ from setuptools import Extension, setup
+ except ImportError:
+- from ez_setup import use_setuptools
+- use_setuptools()
++ #from ez_setup import use_setuptools
++ #use_setuptools()
+ from setuptools import Extension, setup
+
+ #######################################################
--- /dev/null
+Description: Removing the call to setuptools
+--- a/setup.py
++++ b/setup.py
+@@ -214,7 +214,7 @@
+ # cp samtools/*.h pysam/*.h pysam/include
+ # cp samtools/win32/*.h pysam/include/win32
+
+-from setuptools import Extension, setup
++#from setuptools import Extension, setup
+
+ #######################################################
+ #######################################################
--- /dev/null
+Author: Andreas Tille <tille@debian.org>
+Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100
+Description: Prevent tests makefile from deleting files which
+ are contained inside the upstream source
+
+--- a/tests/Makefile
++++ b/tests/Makefile
+@@ -47,6 +47,11 @@
+ samtools view -bS $< > $@
+
+ clean:
++ mkdir keep_bam_files
++ mv ex9_fail.bam ex9_nofail.bam example_btag.bam example_empty_header.bam issue100.bam tag_bug.bam test_unaligned.bam keep_bam_files
+ rm -fr *.bam *.bai *.fai *.pileup* \
+ *~ calDepth *.dSYM pysam_*.sam \
+ ex2.sam ex2.sam.gz ex1.sam
++ mv keep_bam_files/* .
++ rmdir keep_bam_files
++ rm -rf pysam_test_work/
--- /dev/null
+Description: CHanged location of setuptools import--- a/setup.py
++++ b/setup.py
+@@ -14,6 +14,7 @@
+ import re
+ import fnmatch
+ import platform
++from setuptools import Extension, setup
+
+ name = "pysam"
+
+@@ -214,7 +215,7 @@
+ # cp samtools/*.h pysam/*.h pysam/include
+ # cp samtools/win32/*.h pysam/include/win32
+
+-from setuptools import Extension, setup
++
+
+ #######################################################
+ #######################################################
--- /dev/null
+Author: Andreas Tille <tille@debian.org>
+Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100
+Description: Create a copy of the test suite script and remove those
+ tests that try to fetch files from network
+
+--- /dev/null
++++ b/tests/pysam_test_offline.py
+@@ -0,0 +1,1816 @@
++#!/usr/bin/env python
++'''unit testing code for pysam.
++
++Execute in the :file:`tests` directory as it requires the Makefile
++and data files located there.
++'''
++
++import pysam
++import unittest
++import os, re, sys
++import itertools
++import collections
++import subprocess
++import shutil
++import logging
++
++IS_PYTHON3 = sys.version_info[0] >= 3
++
++if IS_PYTHON3:
++ from itertools import zip_longest
++else:
++ from itertools import izip as zip_longest
++
++
++SAMTOOLS="samtools"
++WORKDIR="pysam_test_work"
++
++def checkBinaryEqual( filename1, filename2 ):
++ '''return true if the two files are binary equal.'''
++ if os.path.getsize( filename1 ) != os.path.getsize( filename2 ):
++ return False
++
++ infile1 = open(filename1, "rb")
++ infile2 = open(filename2, "rb")
++
++ def chariter( infile ):
++ while 1:
++ c = infile.read(1)
++ if c == b"": break
++ yield c
++
++ found = False
++ for c1,c2 in zip_longest( chariter( infile1), chariter( infile2) ):
++ if c1 != c2: break
++ else:
++ found = True
++
++ infile1.close()
++ infile2.close()
++ return found
++
++def runSamtools( cmd ):
++ '''run a samtools command'''
++
++ try:
++ retcode = subprocess.call(cmd, shell=True,
++ stderr = subprocess.PIPE)
++ if retcode < 0:
++ print("Child was terminated by signal", -retcode)
++ except OSError as e:
++ print("Execution failed:", e)
++
++def getSamtoolsVersion():
++ '''return samtools version'''
++
++ with subprocess.Popen(SAMTOOLS, shell=True, stderr=subprocess.PIPE).stderr as pipe:
++ lines = b"".join(pipe.readlines())
++
++ if IS_PYTHON3:
++ lines = lines.decode('ascii')
++ return re.search( "Version:\s+(\S+)", lines).groups()[0]
++
++class BinaryTest(unittest.TestCase):
++ '''test samtools command line commands and compare
++ against pysam commands.
++
++ Tests fail, if the output is not binary identical.
++ '''
++
++ first_time = True
++
++ # a dictionary of commands to test
++ # first entry: (samtools output file, samtools command)
++ # second entry: (pysam output file, (pysam function, pysam options) )
++ commands = \
++ {
++ "view" :
++ (
++ ("ex1.view", "view ex1.bam > ex1.view"),
++ ("pysam_ex1.view", (pysam.view, "ex1.bam" ) ),
++ ),
++ "view2" :
++ (
++ ("ex1.view", "view -bT ex1.fa -o ex1.view2 ex1.sam"),
++ # note that -o ex1.view2 throws exception.
++ ("pysam_ex1.view", (pysam.view, "-bT ex1.fa -oex1.view2 ex1.sam" ) ),
++ ),
++ "sort" :
++ (
++ ( "ex1.sort.bam", "sort ex1.bam ex1.sort" ),
++ ( "pysam_ex1.sort.bam", (pysam.sort, "ex1.bam pysam_ex1.sort" ) ),
++ ),
++ "mpileup" :
++ (
++ ("ex1.pileup", "mpileup ex1.bam > ex1.pileup" ),
++ ("pysam_ex1.mpileup", (pysam.mpileup, "ex1.bam" ) ),
++ ),
++ "depth" :
++ (
++ ("ex1.depth", "depth ex1.bam > ex1.depth" ),
++ ("pysam_ex1.depth", (pysam.depth, "ex1.bam" ) ),
++ ),
++ "faidx" :
++ (
++ ("ex1.fa.fai", "faidx ex1.fa"),
++ ("pysam_ex1.fa.fai", (pysam.faidx, "ex1.fa") ),
++ ),
++ "index":
++ (
++ ("ex1.bam.bai", "index ex1.bam" ),
++ ("pysam_ex1.bam.bai", (pysam.index, "pysam_ex1.bam" ) ),
++ ),
++ "idxstats" :
++ (
++ ("ex1.idxstats", "idxstats ex1.bam > ex1.idxstats" ),
++ ("pysam_ex1.idxstats", (pysam.idxstats, "pysam_ex1.bam" ) ),
++ ),
++ "fixmate" :
++ (
++ ("ex1.fixmate", "fixmate ex1.bam ex1.fixmate" ),
++ ("pysam_ex1.fixmate", (pysam.fixmate, "pysam_ex1.bam pysam_ex1.fixmate") ),
++ ),
++ "flagstat" :
++ (
++ ("ex1.flagstat", "flagstat ex1.bam > ex1.flagstat" ),
++ ("pysam_ex1.flagstat", (pysam.flagstat, "pysam_ex1.bam") ),
++ ),
++ "calmd" :
++ (
++ ("ex1.calmd", "calmd ex1.bam ex1.fa > ex1.calmd" ),
++ ("pysam_ex1.calmd", (pysam.calmd, "pysam_ex1.bam ex1.fa") ),
++ ),
++ "merge" :
++ (
++ ("ex1.merge", "merge -f ex1.merge ex1.bam ex1.bam" ),
++ # -f option does not work - following command will cause the subsequent
++ # command to fail
++ ("pysam_ex1.merge", (pysam.merge, "pysam_ex1.merge pysam_ex1.bam pysam_ex1.bam") ),
++ ),
++ "rmdup" :
++ (
++ ("ex1.rmdup", "rmdup ex1.bam ex1.rmdup" ),
++ ("pysam_ex1.rmdup", (pysam.rmdup, "pysam_ex1.bam pysam_ex1.rmdup" )),
++ ),
++ "reheader" :
++ (
++ ( "ex1.reheader", "reheader ex1.bam ex1.bam > ex1.reheader"),
++ ( "pysam_ex1.reheader", (pysam.reheader, "ex1.bam ex1.bam" ) ),
++ ),
++ "cat":
++ (
++ ( "ex1.cat", "cat ex1.bam ex1.bam > ex1.cat"),
++ ( "pysam_ex1.cat", (pysam.cat, "ex1.bam ex1.bam" ) ),
++ ),
++ "targetcut":
++ (
++ ("ex1.targetcut", "targetcut ex1.bam > ex1.targetcut" ),
++ ("pysam_ex1.targetcut", (pysam.targetcut, "pysam_ex1.bam") ),
++ ),
++ "phase":
++ (
++ ("ex1.phase", "phase ex1.bam > ex1.phase" ),
++ ("pysam_ex1.phase", (pysam.phase, "pysam_ex1.bam") ),
++ ),
++ "import" :
++ (
++ ("ex1.bam", "import ex1.fa.fai ex1.sam.gz ex1.bam" ),
++ ("pysam_ex1.bam", (pysam.samimport, "ex1.fa.fai ex1.sam.gz pysam_ex1.bam") ),
++ ),
++ "bam2fq":
++ (
++ ("ex1.bam2fq", "bam2fq ex1.bam > ex1.bam2fq" ),
++ ("pysam_ex1.bam2fq", (pysam.bam2fq, "pysam_ex1.bam") ),
++ ),
++ "pad2unpad":
++ (
++ ("ex2.unpad", "pad2unpad -T ex1.fa ex2.bam > ex2.unpad" ),
++ ("pysam_ex2.unpad", (pysam.pad2unpad, "-T ex1.fa ex2.bam") ),
++ ),
++ "bamshuf":
++ (
++ ("ex1.bamshuf.bam", "bamshuf ex1.bam ex1.bamshuf" ),
++ ("pysam_ex1.bamshuf.bam", (pysam.bamshuf, "ex1.bam pysam_ex1.bamshuf") ),
++ ),
++ "bedcov":
++ (
++ ("ex1.bedcov", "bedcov ex1.bed ex1.bam > ex1.bedcov" ),
++ ("pysam_ex1.bedcov", (pysam.bedcov, "ex1.bed ex1.bam") ),
++ ),
++ }
++
++ # some tests depend on others. The order specifies in which order
++ # the samtools commands are executed.
++ # The first three (faidx, import, index) need to be in that order,
++ # the rest is arbitrary.
++ order = ('faidx', 'import', 'index',
++ # 'pileup1', 'pileup2', deprecated
++ # 'glfview', deprecated
++ 'view', 'view2',
++ 'sort',
++ 'mpileup',
++ 'depth',
++ 'idxstats',
++ 'fixmate',
++ 'flagstat',
++ ## 'calmd',
++ 'merge',
++ 'rmdup',
++ 'reheader',
++ 'cat',
++ 'bedcov',
++ 'targetcut',
++ 'phase',
++ 'bamshuf',
++ 'bam2fq',
++ 'pad2unpad',
++ )
++
++ def setUp( self ):
++ '''setup tests.
++
++ For setup, all commands will be run before the first test is
++ executed. Individual tests will then just compare the output
++ files.
++ '''
++ if BinaryTest.first_time:
++
++ # remove previous files
++ if os.path.exists( WORKDIR ):
++ shutil.rmtree( WORKDIR )
++ pass
++
++ # copy the source files to WORKDIR
++ os.makedirs( WORKDIR )
++
++ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "pysam_ex1.fa" ) )
++ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "ex1.fa" ) )
++ shutil.copy( "ex1.sam.gz", os.path.join( WORKDIR, "ex1.sam.gz" ) )
++ shutil.copy( "ex1.sam", os.path.join( WORKDIR, "ex1.sam" ) )
++ shutil.copy( "ex2.bam", os.path.join( WORKDIR, "ex2.bam" ) )
++
++ # cd to workdir
++ savedir = os.getcwd()
++ os.chdir( WORKDIR )
++
++ for label in self.order:
++ # print ("command=", label)
++ command = self.commands[label]
++ # build samtools command and target and run
++ samtools_target, samtools_command = command[0]
++ runSamtools( " ".join( (SAMTOOLS, samtools_command )))
++
++ # get pysam command and run
++ try:
++ pysam_target, pysam_command = command[1]
++ except ValueError as msg:
++ raise ValueError( "error while setting up %s=%s: %s" %\
++ (label, command, msg) )
++
++ pysam_method, pysam_options = pysam_command
++ try:
++ output = pysam_method( *pysam_options.split(" "), raw=True)
++ except pysam.SamtoolsError as msg:
++ raise pysam.SamtoolsError( "error while executing %s: options=%s: msg=%s" %\
++ (label, pysam_options, msg) )
++
++
++ if ">" in samtools_command:
++ with open( pysam_target, "wb" ) as outfile:
++ if type(output) == list:
++ if IS_PYTHON3:
++ for line in output:
++ outfile.write( line.encode('ascii') )
++ else:
++ for line in output: outfile.write( line )
++ else:
++ outfile.write(output)
++
++ os.chdir( savedir )
++ BinaryTest.first_time = False
++
++ samtools_version = getSamtoolsVersion()
++
++
++ def _r( s ):
++ # patch - remove any of the alpha/beta suffixes, i.e., 0.1.12a -> 0.1.12
++ if s.count('-') > 0: s = s[0:s.find('-')]
++ return re.sub( "[^0-9.]", "", s )
++
++ if _r(samtools_version) != _r( pysam.__samtools_version__):
++ raise ValueError("versions of pysam/samtools and samtools differ: %s != %s" % \
++ (pysam.__samtools_version__,
++ samtools_version ))
++
++ def checkCommand( self, command ):
++ if command:
++ samtools_target, pysam_target = self.commands[command][0][0], self.commands[command][1][0]
++ samtools_target = os.path.join( WORKDIR, samtools_target )
++ pysam_target = os.path.join( WORKDIR, pysam_target )
++ self.assertTrue( checkBinaryEqual( samtools_target, pysam_target ),
++ "%s failed: files %s and %s are not the same" % (command, samtools_target, pysam_target) )
++
++ def testImport( self ):
++ self.checkCommand( "import" )
++
++ def testIndex( self ):
++ self.checkCommand( "index" )
++
++ def testSort( self ):
++ self.checkCommand( "sort" )
++
++ def testMpileup( self ):
++ self.checkCommand( "mpileup" )
++
++ def testDepth( self ):
++ self.checkCommand( "depth" )
++
++ def testIdxstats( self ):
++ self.checkCommand( "idxstats" )
++
++ def testFixmate( self ):
++ self.checkCommand( "fixmate" )
++
++ def testFlagstat( self ):
++ self.checkCommand( "flagstat" )
++
++ def testMerge( self ):
++ self.checkCommand( "merge" )
++
++ def testRmdup( self ):
++ self.checkCommand( "rmdup" )
++
++ def testReheader( self ):
++ self.checkCommand( "reheader" )
++
++ def testCat( self ):
++ self.checkCommand( "cat" )
++
++ def testTargetcut( self ):
++ self.checkCommand( "targetcut" )
++
++ def testPhase( self ):
++ self.checkCommand( "phase" )
++
++ def testBam2fq( self ):
++ self.checkCommand( "bam2fq" )
++
++ def testBedcov( self ):
++ self.checkCommand( "bedcov" )
++
++ def testBamshuf( self ):
++ self.checkCommand( "bamshuf" )
++
++ def testPad2Unpad( self ):
++ self.checkCommand( "pad2unpad" )
++
++ # def testPileup1( self ):
++ # self.checkCommand( "pileup1" )
++
++ # def testPileup2( self ):
++ # self.checkCommand( "pileup2" )
++
++ # deprecated
++ # def testGLFView( self ):
++ # self.checkCommand( "glfview" )
++
++ def testView( self ):
++ self.checkCommand( "view" )
++
++ def testEmptyIndex( self ):
++ self.assertRaises( IOError, pysam.index, "exdoesntexist.bam" )
++
++ def __del__(self):
++ if os.path.exists( WORKDIR ):
++ pass
++ # shutil.rmtree( WORKDIR )
++
++class IOTest(unittest.TestCase):
++ '''check if reading samfile and writing a samfile are consistent.'''
++
++ def checkEcho( self, input_filename,
++ reference_filename,
++ output_filename,
++ input_mode, output_mode, use_template = True ):
++ '''iterate through *input_filename* writing to *output_filename* and
++ comparing the output to *reference_filename*.
++
++ The files are opened according to the *input_mode* and *output_mode*.
++
++ If *use_template* is set, the header is copied from infile using the
++ template mechanism, otherwise target names and lengths are passed
++ explicitely.
++
++ '''
++
++ infile = pysam.Samfile( input_filename, input_mode )
++ if use_template:
++ outfile = pysam.Samfile( output_filename, output_mode, template = infile )
++ else:
++ outfile = pysam.Samfile( output_filename, output_mode,
++ referencenames = infile.references,
++ referencelengths = infile.lengths,
++ add_sq_text = False )
++
++ iter = infile.fetch()
++
++ for x in iter: outfile.write( x )
++ infile.close()
++ outfile.close()
++
++ self.assertTrue( checkBinaryEqual( reference_filename, output_filename),
++ "files %s and %s are not the same" % (reference_filename, output_filename) )
++
++
++ def testReadWriteBam( self ):
++
++ input_filename = "ex1.bam"
++ output_filename = "pysam_ex1.bam"
++ reference_filename = "ex1.bam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "rb", "wb" )
++
++ def testReadWriteBamWithTargetNames( self ):
++
++ input_filename = "ex1.bam"
++ output_filename = "pysam_ex1.bam"
++ reference_filename = "ex1.bam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "rb", "wb", use_template = False )
++
++ def testReadWriteSamWithHeader( self ):
++
++ input_filename = "ex2.sam"
++ output_filename = "pysam_ex2.sam"
++ reference_filename = "ex2.sam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "r", "wh" )
++
++ def testReadWriteSamWithoutHeader( self ):
++
++ input_filename = "ex2.sam"
++ output_filename = "pysam_ex2.sam"
++ reference_filename = "ex1.sam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "r", "w" )
++
++ def testReadSamWithoutTargetNames( self ):
++ '''see issue 104.'''
++ input_filename = "example_unmapped_reads_no_sq.sam"
++
++ # raise exception in default mode
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++ # raise exception if no SQ files
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++ check_header = True)
++
++ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False )
++ result = list(infile.fetch())
++
++ def testReadBamWithoutTargetNames( self ):
++ '''see issue 104.'''
++ input_filename = "example_unmapped_reads_no_sq.bam"
++
++ # raise exception in default mode
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++ # raise exception if no SQ files
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++ check_header = True)
++
++
++ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False )
++ result = list(infile.fetch( until_eof = True))
++
++ def testReadSamWithoutHeader( self ):
++ input_filename = "ex1.sam"
++ output_filename = "pysam_ex1.sam"
++ reference_filename = "ex1.sam"
++
++ # reading from a samfile without header is not implemented.
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++ check_header = False )
++
++ def testReadUnformattedFile( self ):
++ '''test reading from a file that is not bam/sam formatted'''
++ input_filename = "example.vcf40"
++
++ # bam - file raise error
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "rb" )
++
++ # sam - file error, but can't fetch
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++ check_header = False)
++
++ def testBAMWithoutAlignedReads( self ):
++ '''see issue 117'''
++ input_filename = "test_unaligned.bam"
++ samfile = pysam.Samfile( input_filename, "rb", check_sq = False )
++ samfile.fetch( until_eof = True )
++
++ def testBAMWithShortBAI( self ):
++ '''see issue 116'''
++ input_filename = "example_bai.bam"
++ samfile = pysam.Samfile( input_filename, "rb", check_sq = False )
++ samfile.fetch( 'chr2' )
++
++ def testFetchFromClosedFile( self ):
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ samfile.close()
++ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
++
++ def testClosedFile( self ):
++ '''test that access to a closed samfile raises ValueError.'''
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ samfile.close()
++ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
++ self.assertRaises( ValueError, samfile.pileup, 'chr1', 100, 120)
++ self.assertRaises( ValueError, samfile.getrname, 0 )
++ self.assertRaises( ValueError, samfile.tell )
++ self.assertRaises( ValueError, samfile.seek, 0 )
++ self.assertRaises( ValueError, getattr, samfile, "nreferences" )
++ self.assertRaises( ValueError, getattr, samfile, "references" )
++ self.assertRaises( ValueError, getattr, samfile, "lengths" )
++ self.assertRaises( ValueError, getattr, samfile, "text" )
++ self.assertRaises( ValueError, getattr, samfile, "header" )
++
++ # write on closed file
++ self.assertEqual( 0, samfile.write(None) )
++
++ def testAutoDetection( self ):
++ '''test if autodetection works.'''
++
++ samfile = pysam.Samfile( "ex3.sam" )
++ self.assertRaises( ValueError, samfile.fetch, 'chr1' )
++ samfile.close()
++
++ samfile = pysam.Samfile( "ex3.bam" )
++ samfile.fetch('chr1')
++ samfile.close()
++
++ def testReadingFromSamFileWithoutHeader( self ):
++ '''read from samfile without header.
++ '''
++ samfile = pysam.Samfile( "ex7.sam", check_header = False, check_sq = False )
++ self.assertRaises( NotImplementedError, samfile.__iter__ )
++
++ def testReadingFromFileWithoutIndex( self ):
++ '''read from bam file without index.'''
++
++ assert not os.path.exists( "ex2.bam.bai" )
++ samfile = pysam.Samfile( "ex2.bam", "rb" )
++ self.assertRaises( ValueError, samfile.fetch )
++ self.assertEqual( len(list( samfile.fetch(until_eof = True) )), 3270 )
++
++ def testReadingUniversalFileMode( self ):
++ '''read from samfile without header.
++ '''
++
++ input_filename = "ex2.sam"
++ output_filename = "pysam_ex2.sam"
++ reference_filename = "ex1.sam"
++
++ self.checkEcho( input_filename, reference_filename, output_filename,
++ "rU", "w" )
++
++class TestFloatTagBug( unittest.TestCase ):
++ '''see issue 71'''
++
++ def testFloatTagBug( self ):
++ '''a float tag before another exposed a parsing bug in bam_aux_get.
++
++ Fixed in 0.1.19
++ '''
++ samfile = pysam.Samfile("tag_bug.bam")
++ read = next(samfile.fetch(until_eof=True))
++ self.assertTrue( ('XC',1) in read.tags )
++ self.assertEqual(read.opt('XC'), 1)
++
++class TestLargeFieldBug( unittest.TestCase ):
++ '''see issue 100'''
++
++ def testLargeFileBug( self ):
++ '''when creating a read with a large entry in the tag field
++ causes an errror:
++ NotImplementedError: tags field too large
++ '''
++ samfile = pysam.Samfile("issue100.bam")
++ read = next(samfile.fetch(until_eof=True))
++ new_read = pysam.AlignedRead()
++ new_read.tags = read.tags
++ self.assertEqual( new_read.tags, read.tags )
++
++class TestTagParsing( unittest.TestCase ):
++ '''tests checking the accuracy of tag setting and retrieval.'''
++
++ def makeRead( self ):
++ a = pysam.AlignedRead()
++ a.qname = "read_12345"
++ a.tid = 0
++ a.seq="ACGT" * 3
++ a.flag = 0
++ a.rname = 0
++ a.pos = 1
++ a.mapq = 20
++ a.cigar = ( (0,10), (2,1), (0,25) )
++ a.mrnm = 0
++ a.mpos=200
++ a.isize = 0
++ a.qual ="1234" * 3
++ # todo: create tags
++ return a
++
++ def testNegativeIntegers( self ):
++ x = -2
++ aligned_read = self.makeRead()
++ aligned_read.tags = [("XD", int(x) ) ]
++ # print (aligned_read.tags)
++
++ def testNegativeIntegers2( self ):
++ x = -2
++ r = self.makeRead()
++ r.tags = [("XD", int(x) ) ]
++ outfile = pysam.Samfile( "test.bam",
++ "wb",
++ referencenames = ("chr1",),
++ referencelengths = (1000,) )
++ outfile.write (r )
++ outfile.close()
++
++ def testCigarString( self ):
++ r = self.makeRead()
++ self.assertEqual( r.cigarstring, "10M1D25M" )
++ r.cigarstring = "20M10D20M"
++ self.assertEqual( r.cigar, [(0,20), (2,10), (0,20)])
++
++ def testLongTags( self ):
++ '''see issue 115'''
++
++ r = self.makeRead()
++ rg = 'HS2000-899_199.L3'
++ tags = [('XC', 85), ('XT', 'M'), ('NM', 5), ('SM', 29), ('AM', 29), ('XM', 1), ('XO', 1), ('XG', 4), ('MD', '37^ACCC29T18'), ('XA','5,+11707,36M1I48M,2;21,-48119779,46M1I38M,2;hs37d5,-10060835,40M1D45M,3;5,+11508,36M1I48M,3;hs37d5,+6743812,36M1I48M,3;19,-59118894,46M1I38M,3;4,-191044002,6M1I78M,3;')]
++
++ r.tags = tags
++ r.tags += [("RG",rg)] * 100
++ tags += [("RG",rg)] * 100
++
++ self.assertEqual( tags, r.tags )
++
++class TestIteratorRow(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def checkRange( self, rnge ):
++ '''compare results from iterator with those from samtools.'''
++ ps = list(self.samfile.fetch(region=rnge))
++ sa = list(pysam.view( "ex1.bam", rnge, raw = True) )
++ self.assertEqual( len(ps), len(sa), "unequal number of results for range %s: %i != %i" % (rnge, len(ps), len(sa) ))
++ # check if the same reads are returned and in the same order
++ for line, (a, b) in enumerate( list(zip( ps, sa )) ):
++ d = b.split("\t")
++ self.assertEqual( a.qname, d[0], "line %i: read id mismatch: %s != %s" % (line, a.rname, d[0]) )
++ self.assertEqual( a.pos, int(d[3])-1, "line %i: read position mismatch: %s != %s, \n%s\n%s\n" % \
++ (line, a.pos, int(d[3])-1,
++ str(a), str(d) ) )
++ if sys.version_info[0] < 3:
++ qual = d[10]
++ else:
++ qual = d[10].encode('ascii')
++ self.assertEqual( a.qual, qual, "line %i: quality mismatch: %s != %s, \n%s\n%s\n" % \
++ (line, a.qual, qual,
++ str(a), str(d) ) )
++
++ def testIteratePerContig(self):
++ '''check random access per contig'''
++ for contig in self.samfile.references:
++ self.checkRange( contig )
++
++ def testIterateRanges(self):
++ '''check random access per range'''
++ for contig, length in zip(self.samfile.references, self.samfile.lengths):
++ for start in range( 1, length, 90):
++ self.checkRange( "%s:%i-%i" % (contig, start, start + 90) ) # this includes empty ranges
++
++ def tearDown(self):
++ self.samfile.close()
++
++
++class TestIteratorRowAll(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def testIterate(self):
++ '''compare results from iterator with those from samtools.'''
++ ps = list(self.samfile.fetch())
++ sa = list(pysam.view( "ex1.bam", raw = True) )
++ self.assertEqual( len(ps), len(sa), "unequal number of results: %i != %i" % (len(ps), len(sa) ))
++ # check if the same reads are returned
++ for line, pair in enumerate( list(zip( ps, sa )) ):
++ data = pair[1].split("\t")
++ self.assertEqual( pair[0].qname, data[0], "read id mismatch in line %i: %s != %s" % (line, pair[0].rname, data[0]) )
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestIteratorColumn(unittest.TestCase):
++ '''test iterator column against contents of ex4.bam.'''
++
++ # note that samfile contains 1-based coordinates
++ # 1D means deletion with respect to reference sequence
++ #
++ mCoverages = { 'chr1' : [ 0 ] * 20 + [1] * 36 + [0] * (100 - 20 -35 ),
++ 'chr2' : [ 0 ] * 20 + [1] * 35 + [0] * (100 - 20 -35 ),
++ }
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex4.bam","rb" )
++
++ def checkRange( self, contig, start = None, end = None, truncate = False ):
++ '''compare results from iterator with those from samtools.'''
++ # check if the same reads are returned and in the same order
++ for column in self.samfile.pileup(contig, start, end, truncate = truncate):
++ if truncate:
++ self.assertGreaterEqual( column.pos, start )
++ self.assertLess( column.pos, end )
++ thiscov = len(column.pileups)
++ refcov = self.mCoverages[self.samfile.getrname(column.tid)][column.pos]
++ self.assertEqual( thiscov, refcov, "wrong coverage at pos %s:%i %i should be %i" % (self.samfile.getrname(column.tid), column.pos, thiscov, refcov))
++
++ def testIterateAll(self):
++ '''check random access per contig'''
++ self.checkRange( None )
++
++ def testIteratePerContig(self):
++ '''check random access per contig'''
++ for contig in self.samfile.references:
++ self.checkRange( contig )
++
++ def testIterateRanges(self):
++ '''check random access per range'''
++ for contig, length in zip(self.samfile.references, self.samfile.lengths):
++ for start in range( 1, length, 90):
++ self.checkRange( contig, start, start + 90 ) # this includes empty ranges
++
++ def testInverse( self ):
++ '''test the inverse, is point-wise pileup accurate.'''
++ for contig, refseq in list(self.mCoverages.items()):
++ refcolumns = sum(refseq)
++ for pos, refcov in enumerate( refseq ):
++ columns = list(self.samfile.pileup( contig, pos, pos+1) )
++ if refcov == 0:
++ # if no read, no coverage
++ self.assertEqual( len(columns), refcov, "wrong number of pileup columns returned for position %s:%i, %i should be %i" %(contig,pos,len(columns), refcov) )
++ elif refcov == 1:
++ # one read, all columns of the read are returned
++ self.assertEqual( len(columns), refcolumns, "pileup incomplete at position %i: got %i, expected %i " %\
++ (pos, len(columns), refcolumns))
++
++ def testIterateTruncate( self ):
++ '''check random access per range'''
++ for contig, length in zip(self.samfile.references, self.samfile.lengths):
++ for start in range( 1, length, 90):
++ self.checkRange( contig, start, start + 90, truncate = True ) # this includes empty ranges
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestIteratorColumn2(unittest.TestCase):
++ '''test iterator column against contents of ex1.bam.'''
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def testStart( self ):
++ #print self.samfile.fetch().next().pos
++ #print self.samfile.pileup().next().pos
++ pass
++
++ def testTruncate( self ):
++ '''see issue 107.'''
++ # note that ranges in regions start from 1
++ p = self.samfile.pileup(region='chr1:170:172', truncate=True)
++ columns = [ x.pos for x in p ]
++ self.assertEqual( len(columns), 3)
++ self.assertEqual( columns, [169,170,171] )
++
++ p = self.samfile.pileup( 'chr1', 169, 172, truncate=True)
++ columns = [ x.pos for x in p ]
++
++ self.assertEqual( len(columns), 3)
++ self.assertEqual( columns, [169,170,171] )
++
++class TestAlignedReadFromBam(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex3.bam","rb" )
++ self.reads=list(self.samfile.fetch())
++
++ def testARqname(self):
++ self.assertEqual( self.reads[0].qname, "read_28833_29006_6945", "read name mismatch in read 1: %s != %s" % (self.reads[0].qname, "read_28833_29006_6945") )
++ self.assertEqual( self.reads[1].qname, "read_28701_28881_323b", "read name mismatch in read 2: %s != %s" % (self.reads[1].qname, "read_28701_28881_323b") )
++
++ def testARflag(self):
++ self.assertEqual( self.reads[0].flag, 99, "flag mismatch in read 1: %s != %s" % (self.reads[0].flag, 99) )
++ self.assertEqual( self.reads[1].flag, 147, "flag mismatch in read 2: %s != %s" % (self.reads[1].flag, 147) )
++
++ def testARrname(self):
++ self.assertEqual( self.reads[0].rname, 0, "chromosome/target id mismatch in read 1: %s != %s" % (self.reads[0].rname, 0) )
++ self.assertEqual( self.reads[1].rname, 1, "chromosome/target id mismatch in read 2: %s != %s" % (self.reads[1].rname, 1) )
++
++ def testARpos(self):
++ self.assertEqual( self.reads[0].pos, 33-1, "mapping position mismatch in read 1: %s != %s" % (self.reads[0].pos, 33-1) )
++ self.assertEqual( self.reads[1].pos, 88-1, "mapping position mismatch in read 2: %s != %s" % (self.reads[1].pos, 88-1) )
++
++ def testARmapq(self):
++ self.assertEqual( self.reads[0].mapq, 20, "mapping quality mismatch in read 1: %s != %s" % (self.reads[0].mapq, 20) )
++ self.assertEqual( self.reads[1].mapq, 30, "mapping quality mismatch in read 2: %s != %s" % (self.reads[1].mapq, 30) )
++
++ def testARcigar(self):
++ self.assertEqual( self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)], "read name length mismatch in read 1: %s != %s" % (self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)]) )
++ self.assertEqual( self.reads[1].cigar, [(0, 35)], "read name length mismatch in read 2: %s != %s" % (self.reads[1].cigar, [(0, 35)]) )
++
++ def testARcigarstring(self):
++ self.assertEqual( self.reads[0].cigarstring, '10M1D25M' )
++ self.assertEqual( self.reads[1].cigarstring, '35M' )
++
++ def testARmrnm(self):
++ self.assertEqual( self.reads[0].mrnm, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].mrnm, 0) )
++ self.assertEqual( self.reads[1].mrnm, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].mrnm, 1) )
++ self.assertEqual( self.reads[0].rnext, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].rnext, 0) )
++ self.assertEqual( self.reads[1].rnext, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].rnext, 1) )
++
++ def testARmpos(self):
++ self.assertEqual( self.reads[0].mpos, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].mpos, 200-1) )
++ self.assertEqual( self.reads[1].mpos, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].mpos, 500-1) )
++ self.assertEqual( self.reads[0].pnext, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].pnext, 200-1) )
++ self.assertEqual( self.reads[1].pnext, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].pnext, 500-1) )
++
++ def testARisize(self):
++ self.assertEqual( self.reads[0].isize, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].isize, 167) )
++ self.assertEqual( self.reads[1].isize, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].isize, 412) )
++ self.assertEqual( self.reads[0].tlen, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].tlen, 167) )
++ self.assertEqual( self.reads[1].tlen, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].tlen, 412) )
++
++ def testARseq(self):
++ self.assertEqual( self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 1: %s != %s" % (self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
++ self.assertEqual( self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "sequence size mismatch in read 2: %s != %s" % (self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") )
++ self.assertEqual( self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 4: %s != %s" % (self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
++
++ def testARqual(self):
++ self.assertEqual( self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 1: %s != %s" % (self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
++ self.assertEqual( self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "quality string mismatch in read 2: %s != %s" % (self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") )
++ self.assertEqual( self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 3: %s != %s" % (self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
++
++ def testARquery(self):
++ self.assertEqual( self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "query mismatch in read 1: %s != %s" % (self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
++ self.assertEqual( self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "query size mismatch in read 2: %s != %s" % (self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") )
++ self.assertEqual( self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT", "query mismatch in read 4: %s != %s" % (self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT") )
++
++ def testARqqual(self):
++ self.assertEqual( self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "qquality string mismatch in read 1: %s != %s" % (self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
++ self.assertEqual( self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "qquality string mismatch in read 2: %s != %s" % (self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") )
++ self.assertEqual( self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22", "qquality string mismatch in read 3: %s != %s" % (self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22") )
++
++ def testPresentOptionalFields(self):
++ self.assertEqual( self.reads[0].opt('NM'), 1, "optional field mismatch in read 1, NM: %s != %s" % (self.reads[0].opt('NM'), 1) )
++ self.assertEqual( self.reads[0].opt('RG'), 'L1', "optional field mismatch in read 1, RG: %s != %s" % (self.reads[0].opt('RG'), 'L1') )
++ self.assertEqual( self.reads[1].opt('RG'), 'L2', "optional field mismatch in read 2, RG: %s != %s" % (self.reads[1].opt('RG'), 'L2') )
++ self.assertEqual( self.reads[1].opt('MF'), 18, "optional field mismatch in read 2, MF: %s != %s" % (self.reads[1].opt('MF'), 18) )
++
++ def testPairedBools(self):
++ self.assertEqual( self.reads[0].is_paired, True, "is paired mismatch in read 1: %s != %s" % (self.reads[0].is_paired, True) )
++ self.assertEqual( self.reads[1].is_paired, True, "is paired mismatch in read 2: %s != %s" % (self.reads[1].is_paired, True) )
++ self.assertEqual( self.reads[0].is_proper_pair, True, "is proper pair mismatch in read 1: %s != %s" % (self.reads[0].is_proper_pair, True) )
++ self.assertEqual( self.reads[1].is_proper_pair, True, "is proper pair mismatch in read 2: %s != %s" % (self.reads[1].is_proper_pair, True) )
++
++ def testTags( self ):
++ self.assertEqual( self.reads[0].tags,
++ [('NM', 1), ('RG', 'L1'),
++ ('PG', 'P1'), ('XT', 'U')] )
++ self.assertEqual( self.reads[1].tags,
++ [('MF', 18), ('RG', 'L2'),
++ ('PG', 'P2'),('XT', 'R') ] )
++
++ def testOpt( self ):
++ self.assertEqual( self.reads[0].opt("XT"), "U" )
++ self.assertEqual( self.reads[1].opt("XT"), "R" )
++
++ def testMissingOpt( self ):
++ self.assertRaises( KeyError, self.reads[0].opt, "XP" )
++
++ def testEmptyOpt( self ):
++ self.assertRaises( KeyError, self.reads[2].opt, "XT" )
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestAlignedReadFromSam(TestAlignedReadFromBam):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex3.sam","r" )
++ self.reads=list(self.samfile.fetch())
++
++# needs to be implemented
++# class TestAlignedReadFromSamWithoutHeader(TestAlignedReadFromBam):
++#
++# def setUp(self):
++# self.samfile=pysam.Samfile( "ex7.sam","r" )
++# self.reads=list(self.samfile.fetch())
++
++class TestHeaderSam(unittest.TestCase):
++
++ header = {'SQ': [{'LN': 1575, 'SN': 'chr1'},
++ {'LN': 1584, 'SN': 'chr2'}],
++ 'RG': [{'LB': 'SC_1', 'ID': 'L1', 'SM': 'NA12891', 'PU': 'SC_1_10', "CN":"name:with:colon"},
++ {'LB': 'SC_2', 'ID': 'L2', 'SM': 'NA12891', 'PU': 'SC_2_12', "CN":"name:with:colon"}],
++ 'PG': [{'ID': 'P1', 'VN': '1.0'}, {'ID': 'P2', 'VN': '1.1'}],
++ 'HD': {'VN': '1.0'},
++ 'CO' : [ 'this is a comment', 'this is another comment'],
++ }
++
++ def compareHeaders( self, a, b ):
++ '''compare two headers a and b.'''
++ for ak,av in a.items():
++ self.assertTrue( ak in b, "key '%s' not in '%s' " % (ak,b) )
++ self.assertEqual( av, b[ak] )
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex3.sam","r" )
++
++ def testHeaders(self):
++ self.compareHeaders( self.header, self.samfile.header )
++ self.compareHeaders( self.samfile.header, self.header )
++
++ def testNameMapping( self ):
++ for x, y in enumerate( ("chr1", "chr2")):
++ tid = self.samfile.gettid( y )
++ ref = self.samfile.getrname( x )
++ self.assertEqual( tid, x )
++ self.assertEqual( ref, y )
++
++ self.assertEqual( self.samfile.gettid("chr?"), -1 )
++ self.assertRaises( ValueError, self.samfile.getrname, 2 )
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestHeaderBam(TestHeaderSam):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex3.bam","rb" )
++
++
++class TestHeader1000Genomes( unittest.TestCase ):
++
++ # bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase2b_alignment/data/NA07048/exome_alignment/NA07048.unmapped.ILLUMINA.bwa.CEU.exome.20120522_p2b.bam"
++ bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase3_EX_or_LC_only_alignment/data/HG00104/alignment/HG00104.chrom11.ILLUMINA.bwa.GBR.low_coverage.20130415.bam"
++
++ def testRead( self ):
++
++ # Skip fetching files from web when building the package
++ #f = pysam.Samfile( self.bamfile, "rb" )
++ #data = f.header.copy()
++ #self.assertTrue( data )
++ self.assertTrue( True )
++
++class TestUnmappedReads(unittest.TestCase):
++
++ def testSAM(self):
++ samfile=pysam.Samfile( "ex5.sam","r" )
++ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 )
++ samfile.close()
++
++ def testBAM(self):
++ samfile=pysam.Samfile( "ex5.bam","rb" )
++ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 )
++ samfile.close()
++
++class TestPileupObjects(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def testPileupColumn(self):
++ for pcolumn1 in self.samfile.pileup( region="chr1:105" ):
++ if pcolumn1.pos == 104:
++ self.assertEqual( pcolumn1.tid, 0, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn1.tid, 0) )
++ self.assertEqual( pcolumn1.pos, 105-1, "position mismatch in position 1: %s != %s" % (pcolumn1.pos, 105-1) )
++ self.assertEqual( pcolumn1.n, 2, "# reads mismatch in position 1: %s != %s" % (pcolumn1.n, 2) )
++ for pcolumn2 in self.samfile.pileup( region="chr2:1480" ):
++ if pcolumn2.pos == 1479:
++ self.assertEqual( pcolumn2.tid, 1, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn2.tid, 1) )
++ self.assertEqual( pcolumn2.pos, 1480-1, "position mismatch in position 1: %s != %s" % (pcolumn2.pos, 1480-1) )
++ self.assertEqual( pcolumn2.n, 12, "# reads mismatch in position 1: %s != %s" % (pcolumn2.n, 12) )
++
++ def testPileupRead(self):
++ for pcolumn1 in self.samfile.pileup( region="chr1:105" ):
++ if pcolumn1.pos == 104:
++ self.assertEqual( len(pcolumn1.pileups), 2, "# reads aligned to column mismatch in position 1: %s != %s" % (len(pcolumn1.pileups), 2) )
++# self.assertEqual( pcolumn1.pileups[0] # need to test additional properties here
++
++ def tearDown(self):
++ self.samfile.close()
++
++ def testIteratorOutOfScope( self ):
++ '''test if exception is raised if pileup col is accessed after iterator is exhausted.'''
++
++ for pileupcol in self.samfile.pileup():
++ pass
++
++ self.assertRaises( ValueError, getattr, pileupcol, "pileups" )
++
++class TestContextManager(unittest.TestCase):
++
++ def testManager( self ):
++ with pysam.Samfile('ex1.bam', 'rb') as samfile:
++ samfile.fetch()
++ self.assertEqual( samfile._isOpen(), False )
++
++class TestExceptions(unittest.TestCase):
++
++ def setUp(self):
++ self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++ def testMissingFile(self):
++
++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "rb" )
++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "r" )
++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "r" )
++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "rb" )
++
++ def testBadContig(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr88" )
++
++ def testMeaninglessCrap(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "skljf" )
++
++ def testBackwardsOrderNewFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, 'chr1', 100, 10 )
++
++ def testBackwardsOrderOldFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:100-10")
++
++ def testOutOfRangeNegativeNewFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, -10 )
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, 0 )
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", -5, -10 )
++
++ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, -10 )
++ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, 0 )
++ self.assertRaises( ValueError, self.samfile.count, "chr1", -5, -10 )
++
++ def testOutOfRangeNegativeOldFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-10" )
++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-0" )
++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5--10" )
++
++ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-10" )
++ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-0" )
++ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5--10" )
++
++ def testOutOfRangNewFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999, 99999999999 )
++ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999, 99999999999 )
++
++ def testOutOfRangeLargeNewFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
++ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
++
++ def testOutOfRangeLargeOldFormat(self):
++ self.assertRaises( ValueError, self.samfile.fetch, "chr1:99999999999999999-999999999999999999" )
++ self.assertRaises( ValueError, self.samfile.count, "chr1:99999999999999999-999999999999999999" )
++
++ def testZeroToZero(self):
++ '''see issue 44'''
++ self.assertEqual( len(list(self.samfile.fetch('chr1', 0, 0))), 0)
++
++ def tearDown(self):
++ self.samfile.close()
++
++class TestWrongFormat(unittest.TestCase):
++ '''test cases for opening files not in bam/sam format.'''
++
++ def testOpenSamAsBam( self ):
++ self.assertRaises( ValueError, pysam.Samfile, 'ex1.sam', 'rb' )
++
++ def testOpenBamAsSam( self ):
++ # test fails, needs to be implemented.
++ # sam.fetch() fails on reading, not on opening
++ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.bam', 'r' )
++ pass
++
++ def testOpenFastaAsSam( self ):
++ # test fails, needs to be implemented.
++ # sam.fetch() fails on reading, not on opening
++ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'r' )
++ pass
++
++ def testOpenFastaAsBam( self ):
++ self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'rb' )
++
++class TestFastaFile(unittest.TestCase):
++
++ mSequences = { 'chr1' :
++ b"CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCTGTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGGGGCTTAACCTCTGGTGACTGCCAGAGCTGCTGGCAAGCTAGAGTCCCATTTGGAGCCCCTCTAAGCCGTTCTATTTGTAATGAAAACTATATTTATGCTATTCAGTTCTAAATATAGAAATTGAAACAGCTGTGTTTAGTGCCTTTGTTCAACCCCCTTGCAACAACCTTGAGAACCCCAGGGAATTTGTCAATGTCAGGGAAGGAGCATTTTGTCAGTTACCAAATGTGTTTATTACCAGAGGGATGGAGGGAAGAGGGACGCTGAAGAACTTTGATGCCCTCTTCTTCCAAAGATGAAACGCGTAACTGCGCTCTCATTCACTCCAGCTCCCTGTCACCCAATGGACCTGTGATATCTGGATTCTGGGAAATTCTTCATCCTGGACCCTGAGAGATTCTGCAGCCCAGCTCCAGATTGCTTGTGGTCTGACAGGCTGCAACTGTGAGCCATCACAATGAACAACAGGAAGAAAAGGTCTTTCAAAAGGTGATGTGTGTTCTCATCAACCTCATACACACACATGGTTTAGGGGTATAATACCTCTACATGGCTGATTATGAAAACAATGTTCCCCAGATACCATCCCTGTCTTACTTCCAGCTCCCCAGAGGGAAAGCTTTCAACGCTTCTAGCCATTTCTTTTGGCATTTGCCTTCAGACCCTACACGAATGCGTCTCTACCACAGGGGGCTGCGCGGTTTCCCATCATGAAGCACTGAACTTCCACGTCTCATCTAGGGGAACAGGGAGGTGCACTAATGCGCTCCACGCCCAAGCCCTTCTCACAGTTTCTGCCCCCAGCATGGTTGTACTGGGCAATACATGAGATTATTAGGAAATGCTTTACTGTCATAACTATGAAGAGACTATTGCCAGATGAACCACACATTAATACTATGTTTCTTATCTGCACATTACTACCCTGCAATTAATATAATTGTGTCCATGTACACACGCTGTCCTATGTACTTATCATGACTCTATCCCAAATTCCCAATTACGTCCTATCTTCTTCTTAGGGAAGAACAGCTTAGGTATCAATTTGGTGTTCTGTGTAAAGTCTCAGGGAGCCGTCCGTGTCCTCCCATCTGGCCTCGTCCACACTGGTTCTCTTGAAAGCTTGGGCTGTAATGATGCCCCTTGGCCATCACCCAGTCCCTGCCCCATCTCTTGTAATCTCTCTCCTTTTTGCTGCATCCCTGTCTTCCTCTGTCTTGATTTACTTGTTGTTGGTTTTCTGTTTCTTTGTTTGATTTGGTGGAAGACATAATCCCACGCTTCCTATGGAAAGGTTGTTGGGAGATTTTTAATGATTCCTCAATGTTAAAATGTCTATTTTTGTCTTGACACCCAACTAATATTTGTCTGAGCAAAACAGTCTAGATGAGAGAGAACTTCCCTGGAGGTCTGATGGCGTTTCTCCCTCGTCTTCTTA",
++ 'chr2' :
++ b"TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAAGAAATTACAAAATATAGTTGAAAGCTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCTTATGAATTAACCCAGTCAGACAAAAATAAAGAAAAAAATTTTAAAAATGAACAGAGCTTTCAAGAAGTATGAGATTATGTAAAGTAACTGAACCTATGAGTCACAGGTATTCCTGAGGAAAAAGAAAAAGTGAGAAGTTTGGAAAAACTATTTGAGGAAGTAATTGGGGAAAACCTCTTTAGTCTTGCTAGAGATTTAGACATCTAAATGAAAGAGGCTCAAAGAATGCCAGGAAGATACATTGCAAGACAGACTTCATCAAGATATGTAGTCATCAGACTATCTAAAGTCAACATGAAGGAAAAAAATTCTAAAATCAGCAAGAGAAAAGCATACAGTCATCTATAAAGGAAATCCCATCAGAATAACAATGGGCTTCTCAGCAGAAACCTTACAAGCCAGAAGAGATTGGATCTAATTTTTGGACTTCTTAAAGAAAAAAAAACCTGTCAAACACGAATGTTATGCCCTGCTAAACTAAGCATCATAAATGAAGGGGAAATAAAGTCAAGTCTTTCCTGACAAGCAAATGCTAAGATAATTCATCATCACTAAACCAGTCCTATAAGAAATGCTCAAAAGAATTGTAAAAGTCAAAATTAAAGTTCAATACTCACCATCATAAATACACACAAAAGTACAAAACTCACAGGTTTTATAAAACAATTGAGACTACAGAGCAACTAGGTAAAAAATTAACATTACAACAGGAACAAAACCTCATATATCAATATTAACTTTGAATAAAAAGGGATTAAATTCCCCCACTTAAGAGATATAGATTGGCAGAACAGATTTAAAAACATGAACTAACTATATGCTGTTTACAAGAAACTCATTAATAAAGACATGAGTTCAGGTAAAGGGGTGGAAAAAGATGTTCTACGCAAACAGAAACCAAATGAGAGAAGGAGTAGCTATACTTATATCAGATAAAGCACACTTTAAATCAACAACAGTAAAATAAAACAAAGGAGGTCATCATACAATGATAAAAAGATCAATTCAGCAAGAAGATATAACCATCCTACTAAATACATATGCACCTAACACAAGACTACCCAGATTCATAAAACAAATACTACTAGACCTAAGAGGGATGAGAAATTACCTAATTGGTACAATGTACAATATTCTGATGATGGTTACACTAAAAGCCCATACTTTACTGCTACTCAATATATCCATGTAACAAATCTGCGCTTGTACTTCTAAATCTATAAAAAAATTAAAATTTAACAAAAGTAAATAAAACACATAGCTAAAACTAAAAAAGCAAAAACAAAAACTATGCTAAGTATTGGTAAAGATGTGGGGAAAAAAGTAAACTCTCAAATATTGCTAGTGGGAGTATAAATTGTTTTCCACTTTGGAAAACAATTTGGTAATTTCGTTTTTTTTTTTTTCTTTTCTCTTTTTTTTTTTTTTTTTTTTGCATGCCAGAAAAAAATATTTACAGTAACT",
++ }
++
++ def setUp(self):
++ self.file=pysam.Fastafile( "ex1.fa" )
++
++ def testFetch(self):
++ for id, seq in list(self.mSequences.items()):
++ self.assertEqual( seq, self.file.fetch( id ) )
++ for x in range( 0, len(seq), 10):
++ self.assertEqual( seq[x:x+10], self.file.fetch( id, x, x+10) )
++ # test x:end
++ self.assertEqual( seq[x:], self.file.fetch( id, x) )
++ # test 0:x
++ self.assertEqual( seq[:x], self.file.fetch( id, None, x) )
++
++
++ # unknown sequence returns ""
++ self.assertEqual( b"", self.file.fetch("chr12") )
++
++ def testOutOfRangeAccess( self ):
++ '''test out of range access.'''
++ # out of range access returns an empty string
++ for contig, s in self.mSequences.items():
++ self.assertEqual( self.file.fetch( contig, len(s), len(s)+1), b"" )
++
++ self.assertEqual( self.file.fetch( "chr3", 0 , 100), b"" )
++
++ def testFetchErrors( self ):
++ self.assertRaises( ValueError, self.file.fetch )
++ self.assertRaises( IndexError, self.file.fetch, "chr1", -1, 10 )
++ self.assertRaises( ValueError, self.file.fetch, "chr1", 20, 10 )
++
++ def testLength( self ):
++ self.assertEqual( len(self.file), 2 )
++
++ def tearDown(self):
++ self.file.close()
++
++class TestAlignedRead(unittest.TestCase):
++ '''tests to check if aligned read can be constructed
++ and manipulated.
++ '''
++
++ def checkFieldEqual( self, read1, read2, exclude = []):
++ '''check if two reads are equal by comparing each field.'''
++
++ for x in ("qname", "seq", "flag",
++ "rname", "pos", "mapq", "cigar",
++ "mrnm", "mpos", "isize", "qual",
++ "is_paired", "is_proper_pair",
++ "is_unmapped", "mate_is_unmapped",
++ "is_reverse", "mate_is_reverse",
++ "is_read1", "is_read2",
++ "is_secondary", "is_qcfail",
++ "is_duplicate", "bin"):
++ if x in exclude: continue
++ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" %
++ (x, getattr(read1, x), getattr(read2,x)))
++
++ def testEmpty( self ):
++ a = pysam.AlignedRead()
++ self.assertEqual( a.qname, None )
++ self.assertEqual( a.seq, None )
++ self.assertEqual( a.qual, None )
++ self.assertEqual( a.flag, 0 )
++ self.assertEqual( a.rname, 0 )
++ self.assertEqual( a.mapq, 0 )
++ self.assertEqual( a.cigar, None )
++ self.assertEqual( a.tags, [] )
++ self.assertEqual( a.mrnm, 0 )
++ self.assertEqual( a.mpos, 0 )
++ self.assertEqual( a.isize, 0 )
++
++ def buildRead( self ):
++ '''build an example read.'''
++
++ a = pysam.AlignedRead()
++ a.qname = "read_12345"
++ a.seq="ACGT" * 10
++ a.flag = 0
++ a.rname = 0
++ a.pos = 20
++ a.mapq = 20
++ a.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) )
++ a.mrnm = 0
++ a.mpos=200
++ a.isize=167
++ a.qual="1234" * 10
++ # todo: create tags
++ return a
++
++ def testUpdate( self ):
++ '''check if updating fields affects other variable length data
++ '''
++ a = self.buildRead()
++ b = self.buildRead()
++
++ # check qname
++ b.qname = "read_123"
++ self.checkFieldEqual( a, b, "qname" )
++ b.qname = "read_12345678"
++ self.checkFieldEqual( a, b, "qname" )
++ b.qname = "read_12345"
++ self.checkFieldEqual( a, b)
++
++ # check cigar
++ b.cigar = ( (0,10), )
++ self.checkFieldEqual( a, b, "cigar" )
++ b.cigar = ( (0,10), (2,1), (0,10) )
++ self.checkFieldEqual( a, b, "cigar" )
++ b.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) )
++ self.checkFieldEqual( a, b)
++
++ # check seq
++ b.seq = "ACGT"
++ self.checkFieldEqual( a, b, ("seq", "qual") )
++ b.seq = "ACGT" * 3
++ self.checkFieldEqual( a, b, ("seq", "qual") )
++ b.seq = "ACGT" * 10
++ self.checkFieldEqual( a, b, ("qual",))
++
++ # reset qual
++ b = self.buildRead()
++
++ # check flags:
++ for x in (
++ "is_paired", "is_proper_pair",
++ "is_unmapped", "mate_is_unmapped",
++ "is_reverse", "mate_is_reverse",
++ "is_read1", "is_read2",
++ "is_secondary", "is_qcfail",
++ "is_duplicate"):
++ setattr( b, x, True )
++ self.assertEqual( getattr(b, x), True )
++ self.checkFieldEqual( a, b, ("flag", x,) )
++ setattr( b, x, False )
++ self.assertEqual( getattr(b, x), False )
++ self.checkFieldEqual( a, b )
++
++ def testLargeRead( self ):
++ '''build an example read.'''
++
++ a = pysam.AlignedRead()
++ a.qname = "read_12345"
++ a.seq="ACGT" * 200
++ a.flag = 0
++ a.rname = 0
++ a.pos = 20
++ a.mapq = 20
++ a.cigar = ( (0, 4 * 200), )
++ a.mrnm = 0
++ a.mpos=200
++ a.isize=167
++ a.qual="1234" * 200
++
++ return a
++
++ def testTagParsing( self ):
++ '''test for tag parsing
++
++ see http://groups.google.com/group/pysam-user-group/browse_thread/thread/67ca204059ea465a
++ '''
++ samfile=pysam.Samfile( "ex8.bam","rb" )
++
++ for entry in samfile:
++ before = entry.tags
++ entry.tags = entry.tags
++ after = entry.tags
++ self.assertEqual( after, before )
++
++ def testUpdateTlen( self ):
++ '''check if updating tlen works'''
++ a = self.buildRead()
++ oldlen = a.tlen
++ oldlen *= 2
++ a.tlen = oldlen
++ self.assertEqual( a.tlen, oldlen )
++
++ def testPositions( self ):
++ a = self.buildRead()
++ self.assertEqual( a.positions,
++ [20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
++ 31, 32, 33, 34, 35, 36, 37, 38, 39,
++ 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
++ 50, 51, 52, 53, 54, 55, 56, 57, 58, 59] )
++
++ self.assertEqual( a.aligned_pairs,
++ [(0, 20), (1, 21), (2, 22), (3, 23), (4, 24),
++ (5, 25), (6, 26), (7, 27), (8, 28), (9, 29),
++ (None, 30),
++ (10, 31), (11, 32), (12, 33), (13, 34), (14, 35),
++ (15, 36), (16, 37), (17, 38), (18, 39), (19, None),
++ (20, 40), (21, 41), (22, 42), (23, 43), (24, 44),
++ (25, 45), (26, 46), (27, 47), (28, 48), (29, 49),
++ (30, 50), (31, 51), (32, 52), (33, 53), (34, 54),
++ (35, 55), (36, 56), (37, 57), (38, 58), (39, 59)] )
++
++ self.assertEqual( a.positions, [x[1] for x in a.aligned_pairs if x[0] != None and x[1] != None] )
++ # alen is the length of the aligned read in genome
++ self.assertEqual( a.alen, a.aligned_pairs[-1][0] + 1 )
++ # aend points to one beyond last aligned base in ref
++ self.assertEqual( a.positions[-1], a.aend - 1 )
++
++class TestDeNovoConstruction(unittest.TestCase):
++ '''check BAM/SAM file construction using ex6.sam
++
++ (note these are +1 coordinates):
++
++ read_28833_29006_6945 99 chr1 33 20 10M1D25M = 200 167 AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG <<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<< NM:i:1 RG:Z:L1
++ read_28701_28881_323b 147 chr2 88 30 35M = 500 412 ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA <<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<< MF:i:18 RG:Z:L2
++ '''
++
++ header = { 'HD': {'VN': '1.0'},
++ 'SQ': [{'LN': 1575, 'SN': 'chr1'},
++ {'LN': 1584, 'SN': 'chr2'}], }
++
++ bamfile = "ex6.bam"
++ samfile = "ex6.sam"
++
++ def checkFieldEqual( self, read1, read2, exclude = []):
++ '''check if two reads are equal by comparing each field.'''
++
++ for x in ("qname", "seq", "flag",
++ "rname", "pos", "mapq", "cigar",
++ "mrnm", "mpos", "isize", "qual",
++ "bin",
++ "is_paired", "is_proper_pair",
++ "is_unmapped", "mate_is_unmapped",
++ "is_reverse", "mate_is_reverse",
++ "is_read1", "is_read2",
++ "is_secondary", "is_qcfail",
++ "is_duplicate"):
++ if x in exclude: continue
++ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" %
++ (x, getattr(read1, x), getattr(read2,x)))
++
++ def setUp( self ):
++
++ a = pysam.AlignedRead()
++ a.qname = "read_28833_29006_6945"
++ a.seq="AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG"
++ a.flag = 99
++ a.rname = 0
++ a.pos = 32
++ a.mapq = 20
++ a.cigar = ( (0,10), (2,1), (0,25) )
++ a.mrnm = 0
++ a.mpos=199
++ a.isize=167
++ a.qual="<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<"
++ a.tags = ( ("NM", 1),
++ ("RG", "L1") )
++
++ b = pysam.AlignedRead()
++ b.qname = "read_28701_28881_323b"
++ b.seq="ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA"
++ b.flag = 147
++ b.rname = 1
++ b.pos = 87
++ b.mapq = 30
++ b.cigar = ( (0,35), )
++ b.mrnm = 1
++ b.mpos=499
++ b.isize=412
++ b.qual="<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<"
++ b.tags = ( ("MF", 18),
++ ("RG", "L2") )
++
++ self.reads = (a,b)
++
++ def testSAMWholeFile( self ):
++
++ tmpfilename = "tmp_%i.sam" % id(self)
++
++ outfile = pysam.Samfile( tmpfilename, "wh", header = self.header )
++
++ for x in self.reads: outfile.write( x )
++ outfile.close()
++ self.assertTrue( checkBinaryEqual( tmpfilename, self.samfile ),
++ "mismatch when construction SAM file, see %s %s" % (tmpfilename, self.samfile))
++
++ os.unlink( tmpfilename )
++
++ def testBAMPerRead( self ):
++ '''check if individual reads are binary equal.'''
++ infile = pysam.Samfile( self.bamfile, "rb")
++
++ others = list(infile)
++ for denovo, other in zip( others, self.reads):
++ self.checkFieldEqual( other, denovo )
++ self.assertEqual( other.compare( denovo ), 0 )
++
++ def testSAMPerRead( self ):
++ '''check if individual reads are binary equal.'''
++ infile = pysam.Samfile( self.samfile, "r")
++
++ others = list(infile)
++ for denovo, other in zip( others, self.reads):
++ self.checkFieldEqual( other, denovo )
++ self.assertEqual( other.compare( denovo), 0 )
++
++ def testBAMWholeFile( self ):
++
++ tmpfilename = "tmp_%i.bam" % id(self)
++
++ outfile = pysam.Samfile( tmpfilename, "wb", header = self.header )
++
++ for x in self.reads: outfile.write( x )
++ outfile.close()
++
++ self.assertTrue( checkBinaryEqual( tmpfilename, self.bamfile ),
++ "mismatch when construction BAM file, see %s %s" % (tmpfilename, self.bamfile))
++
++ os.unlink( tmpfilename )
++
++class TestDeNovoConstructionUserTags(TestDeNovoConstruction):
++ '''test de novo construction with a header that contains lower-case tags.'''
++
++ header = { 'HD': {'VN': '1.0'},
++ 'SQ': [{'LN': 1575, 'SN': 'chr1'},
++ {'LN': 1584, 'SN': 'chr2'}],
++ 'x1': {'A': 2, 'B': 5 },
++ 'x3': {'A': 6, 'B': 5 },
++ 'x2': {'A': 4, 'B': 5 } }
++
++ bamfile = "example_user_header.bam"
++ samfile = "example_user_header.sam"
++
++class TestEmptyHeader( unittest.TestCase ):
++ '''see issue 84.'''
++
++ def testEmptyHeader( self ):
++
++ s = pysam.Samfile('example_empty_header.bam')
++ self.assertEqual( s.header, {'SQ': [{'LN': 1000, 'SN': 'chr1'}]} )
++
++class TestBTagSam( unittest.TestCase ):
++ '''see issue 81.'''
++
++ compare = [ [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95],
++ [-100,200,-300,-400],
++ [-100,12],
++ [12,15],
++ [-1.0,5.0,2.5] ]
++
++ filename = 'example_btag.sam'
++
++ def testRead( self ):
++
++ s = pysam.Samfile(self.filename)
++ for x, read in enumerate(s):
++ if x == 0:
++ self.assertEqual( read.tags, [('RG', 'QW85I'), ('PG', 'tmap'), ('MD', '140'), ('NM', 0), ('AS', 140), ('FZ', [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95]), ('XA', 'map2-1'), ('XS', 53), ('XT', 38), ('XF', 1), ('XE', 0)]
++ )
++
++ fz = dict(read.tags)["FZ"]
++ self.assertEqual( fz, self.compare[x] )
++ self.assertEqual( read.opt("FZ"), self.compare[x])
++
++ def testWrite( self ):
++
++ s = pysam.Samfile(self.filename)
++ for read in s:
++ before = read.tags
++ read.tags = read.tags
++ after = read.tags
++ self.assertEqual( after, before )
++
++class TestBTagBam( TestBTagSam ):
++ filename = 'example_btag.bam'
++
++class TestDoubleFetch(unittest.TestCase):
++ '''check if two iterators on the same bamfile are independent.'''
++
++ def testDoubleFetch( self ):
++
++ samfile1 = pysam.Samfile('ex1.bam', 'rb')
++
++ for a,b in zip(samfile1.fetch(), samfile1.fetch()):
++ self.assertEqual( a.compare( b ), 0 )
++
++ def testDoubleFetchWithRegion( self ):
++
++ samfile1 = pysam.Samfile('ex1.bam', 'rb')
++ chr, start, stop = 'chr1', 200, 3000000
++ self.assertTrue(len(list(samfile1.fetch ( chr, start, stop))) > 0) #just making sure the test has something to catch
++
++ for a,b in zip(samfile1.fetch( chr, start, stop), samfile1.fetch( chr, start, stop)):
++ self.assertEqual( a.compare( b ), 0 )
++
++ def testDoubleFetchUntilEOF( self ):
++
++ samfile1 = pysam.Samfile('ex1.bam', 'rb')
++
++ for a,b in zip(samfile1.fetch( until_eof = True),
++ samfile1.fetch( until_eof = True )):
++ self.assertEqual( a.compare( b), 0 )
++
++class TestRemoteFileFTP(unittest.TestCase):
++ '''test remote access.
++
++ '''
++
++ # Need to find an ftp server without password on standard
++ # port.
++
++ url = "ftp://ftp.sanger.ac.uk/pub/rd/humanSequences/CV.bam"
++ region = "1:1-1000"
++
++ def testFTPView( self ):
++ return
++ result = pysam.view( self.url, self.region )
++ self.assertEqual( len(result), 36 )
++
++ def testFTPFetch( self ):
++ return
++ samfile = pysam.Samfile(self.url, "rb")
++ result = list(samfile.fetch( region = self.region ))
++ self.assertEqual( len(result), 36 )
++
++class TestLargeOptValues( unittest.TestCase ):
++
++ ints = ( 65536, 214748, 2147484, 2147483647 )
++ floats = ( 65536.0, 214748.0, 2147484.0 )
++
++ def check( self, samfile ):
++
++ i = samfile.fetch()
++ for exp in self.ints:
++ rr = next(i)
++ obs = rr.opt("ZP")
++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++ for exp in [ -x for x in self.ints ]:
++ rr = next(i)
++ obs = rr.opt("ZP")
++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++ for exp in self.floats:
++ rr = next(i)
++ obs = rr.opt("ZP")
++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++ for exp in [ -x for x in self.floats ]:
++ rr = next(i)
++ obs = rr.opt("ZP")
++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++ def testSAM( self ):
++ samfile = pysam.Samfile("ex10.sam", "r")
++ self.check( samfile )
++
++ def testBAM( self ):
++ samfile = pysam.Samfile("ex10.bam", "rb")
++ self.check( samfile )
++
++# class TestSNPCalls( unittest.TestCase ):
++# '''test pysam SNP calling ability.'''
++
++# def checkEqual( self, a, b ):
++# for x in ("reference_base",
++# "pos",
++# "genotype",
++# "consensus_quality",
++# "snp_quality",
++# "mapping_quality",
++# "coverage" ):
++# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" %
++# (x, getattr(a, x), getattr(b,x), str(a), str(b)))
++
++# def testAllPositionsViaIterator( self ):
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# try:
++# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base != "*"]
++# except pysam.SamtoolsError:
++# pass
++
++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++# calls = list(pysam.IteratorSNPCalls(i))
++# for x,y in zip( refs, calls ):
++# self.checkEqual( x, y )
++
++# def testPerPositionViaIterator( self ):
++# # test pileup for each position. This is a slow operation
++# # so this test is disabled
++# return
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
++# if x.reference_base == "*": continue
++# i = samfile.pileup( x.chromosome, x.pos, x.pos+1,
++# fastafile = fastafile,
++# stepper = "samtools" )
++# z = [ zz for zz in pysam.IteratorSamtools(i) if zz.pos == x.pos ]
++# self.assertEqual( len(z), 1 )
++# self.checkEqual( x, z[0] )
++
++# def testPerPositionViaCaller( self ):
++# # test pileup for each position. This is a fast operation
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++# caller = pysam.SNPCaller( i )
++
++# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
++# if x.reference_base == "*": continue
++# call = caller.call( x.chromosome, x.pos )
++# self.checkEqual( x, call )
++
++# class TestIndelCalls( unittest.TestCase ):
++# '''test pysam indel calling.'''
++
++# def checkEqual( self, a, b ):
++
++# for x in ("pos",
++# "genotype",
++# "consensus_quality",
++# "snp_quality",
++# "mapping_quality",
++# "coverage",
++# "first_allele",
++# "second_allele",
++# "reads_first",
++# "reads_second",
++# "reads_diff"):
++# if b.genotype == "*/*" and x == "second_allele":
++# # ignore test for second allele (positions chr2:439 and chr2:1512)
++# continue
++# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" %
++# (x, getattr(a, x), getattr(b,x), str(a), str(b)))
++
++# def testAllPositionsViaIterator( self ):
++
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# try:
++# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base == "*"]
++# except pysam.SamtoolsError:
++# pass
++
++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++# calls = [ x for x in list(pysam.IteratorIndelCalls(i)) if x != None ]
++# for x,y in zip( refs, calls ):
++# self.checkEqual( x, y )
++
++# def testPerPositionViaCaller( self ):
++# # test pileup for each position. This is a fast operation
++# samfile = pysam.Samfile( "ex1.bam", "rb")
++# fastafile = pysam.Fastafile( "ex1.fa" )
++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++# caller = pysam.IndelCaller( i )
++
++# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
++# if x.reference_base != "*": continue
++# call = caller.call( x.chromosome, x.pos )
++# self.checkEqual( x, call )
++
++class TestLogging( unittest.TestCase ):
++ '''test around bug issue 42,
++
++ failed in versions < 0.4
++ '''
++
++ def check( self, bamfile, log ):
++
++ if log:
++ logger = logging.getLogger('franklin')
++ logger.setLevel(logging.INFO)
++ formatter = logging.Formatter('%(asctime)s %(levelname)s %(message)s')
++ log_hand = logging.FileHandler('log.txt')
++ log_hand.setFormatter(formatter)
++ logger.addHandler(log_hand)
++
++ bam = pysam.Samfile(bamfile, 'rb')
++ cols = bam.pileup()
++ self.assertTrue( True )
++
++ def testFail1( self ):
++ self.check( "ex9_fail.bam", False )
++ self.check( "ex9_fail.bam", True )
++
++ def testNoFail1( self ):
++ self.check( "ex9_nofail.bam", False )
++ self.check( "ex9_nofail.bam", True )
++
++ def testNoFail2( self ):
++ self.check( "ex9_nofail.bam", True )
++ self.check( "ex9_nofail.bam", True )
++
++# TODOS
++# 1. finish testing all properties within pileup objects
++# 2. check exceptions and bad input problems (missing files, optional fields that aren't present, etc...)
++# 3. check: presence of sequence
++
++class TestSamfileUtilityFunctions( unittest.TestCase ):
++
++ def testCount( self ):
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++
++ for contig in ("chr1", "chr2" ):
++ for start in range( 0, 2000, 100 ):
++ end = start + 1
++ self.assertEqual( len( list( samfile.fetch( contig, start, end ) ) ),
++ samfile.count( contig, start, end ) )
++
++ # test empty intervals
++ self.assertEqual( len( list( samfile.fetch( contig, start, start ) ) ),
++ samfile.count( contig, start, start ) )
++
++ # test half empty intervals
++ self.assertEqual( len( list( samfile.fetch( contig, start ) ) ),
++ samfile.count( contig, start ) )
++
++ def testMate( self ):
++ '''test mate access.'''
++
++ with open( "ex1.sam", "rb" ) as inf:
++ readnames = [ x.split(b"\t")[0] for x in inf.readlines() ]
++ if sys.version_info[0] >= 3:
++ readnames = [ name.decode('ascii') for name in readnames ]
++
++ counts = collections.defaultdict( int )
++ for x in readnames: counts[x] += 1
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ for read in samfile.fetch():
++ if not read.is_paired:
++ self.assertRaises( ValueError, samfile.mate, read )
++ elif read.mate_is_unmapped:
++ self.assertRaises( ValueError, samfile.mate, read )
++ else:
++ if counts[read.qname] == 1:
++ self.assertRaises( ValueError, samfile.mate, read )
++ else:
++ mate = samfile.mate( read )
++ self.assertEqual( read.qname, mate.qname )
++ self.assertEqual( read.is_read1, mate.is_read2 )
++ self.assertEqual( read.is_read2, mate.is_read1 )
++ self.assertEqual( read.pos, mate.mpos )
++ self.assertEqual( read.mpos, mate.pos )
++
++ def testIndexStats( self ):
++ '''test if total number of mapped/unmapped reads is correct.'''
++
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ self.assertEqual( samfile.mapped, 3235 )
++ self.assertEqual( samfile.unmapped, 35 )
++
++class TestSamtoolsProxy( unittest.TestCase ):
++ '''tests for sanity checking access to samtools functions.'''
++
++ def testIndex( self ):
++ self.assertRaises( IOError, pysam.index, "missing_file" )
++
++ def testView( self ):
++ # note that view still echos "open: No such file or directory"
++ self.assertRaises( pysam.SamtoolsError, pysam.view, "missing_file" )
++
++ def testSort( self ):
++ self.assertRaises( pysam.SamtoolsError, pysam.sort, "missing_file" )
++
++class TestSamfileIndex( unittest.TestCase):
++
++ def testIndex( self ):
++ samfile = pysam.Samfile( "ex1.bam", "rb" )
++ index = pysam.IndexedReads( samfile )
++ index.build()
++
++ reads = collections.defaultdict( int )
++
++ for read in samfile: reads[read.qname] += 1
++
++ for qname, counts in reads.items():
++ found = list(index.find( qname ))
++ self.assertEqual( len(found), counts )
++ for x in found: self.assertEqual( x.qname, qname )
++
++
++if __name__ == "__main__":
++ # build data files
++ print ("building data files")
++ subprocess.call( "make", shell=True)
++ print ("starting tests")
++ unittest.main()
++ print ("completed tests")
--- /dev/null
+import-setuptools-at-the-beginning.patch
--- /dev/null
+Author: Andreas Tille <tille@debian.org>
+Date: Tue, 19 Aug 2014 21:26:37 +0200
+Description: setup.py allows to use external htslib which we do hereby
+
+--- a/setup.py
++++ b/setup.py
+@@ -32,7 +32,7 @@ IS_PYTHON3 = sys.version_info[0] >= 3
+ # pysam.
+ # external: use shared libhts.so compiled outside of
+ # pysam
+-HTSLIB = "separate"
++HTSLIB = "external"
+ HTSLIB_DIR = []
+
+ # collect pysam version
+@@ -55,6 +55,7 @@ tabix_dest = os.path.abspath("tabix")
+ if HTSLIB == 'external':
+ htslib_sources = []
+ chtslib_sources = []
++ shared_htslib_sources = htslib_sources
+ htslib_library_dirs = HTSLIB_DIR
+ htslib_libraries = ['hts']
+ elif HTSLIB == 'separate':
--- /dev/null
+Pysam for Debian
+================
+
+To verify whether your python-pysam modules are working correctly
+you can run the test suite manually by running the script
+
+ run-unit-test
+
+in this directory.
+
+ -- Andreas Tille <tille@debian.org> Fri, 07 Feb 2014 18:29:40 +0100
+
--- /dev/null
+debian/tests/run-unit-test
--- /dev/null
+tests usr/share/doc/python-pysam
--- /dev/null
+#!/usr/bin/make -f
+
+export PYBUILD_NAME=pysam
+
+DEBPKGNAME := $(shell dpkg-parsechangelog | awk '/^Source:/ {print $$2}')
+TESTPKG := $(DEBPKGNAME)-tests
+
+HTSLIBDIR := /usr/lib/$(shell dpkg-architecture -qDEB_HOST_GNU_TYPE)
+
+# DEB_BUILD_OPTIONS := nocheck
+
+%:
+ dh $@ --with python3 --buildsystem=pybuild
+
+# Make sure Cython is recreating some c-files. To enable building twice in a
+# row these will be saved in advance and restored afterwards
+# debian/savefiles:
+# if grep -q -l "Generated by Cython" pysam/*.c ; then \
+# mkdir -p debian/savefiles ; \
+# mv `grep -l "Generated by Cython" pysam/*.c` debian/savefiles ; \
+# fi
+
+# override_dh_clean:
+# dh_clean
+# # restore cython generated files
+# if [ -d debian/savefiles ] ; then \
+# mv debian/savefiles/* pysam ; \
+# rm -rf debian/savefiles ; \
+# fi
+
+# override_dh_auto_build: debian/savefiles
+# HTSLIB_LIBRARY_DIR=$(HTSLIBDIR) HTSLIB_INCLUDE_DIR=/usr/include dh_auto_build
+
+# override_dh_auto_test:
+# ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS)))
+# LC_ALL=C.UTF-8 dh_auto_test -- --test --system=custom \
+# --test-args='set -e; \
+# cp -a $(CURDIR)/tests {build_dir}/tests ; \
+# cd {build_dir}/tests && HTSLIB_LIBRARY_DIR=$(HTSLIBDIR) HTSLIB_INCLUDE_DIR=/usr/include PYTHONPATH={build_dir} {interpreter} ./pysam_test.py \
+# && HTSLIB_LIBRARY_DIR=$(HTSLIBDIR) HTSLIB_INCLUDE_DIR=/usr/include PYTHONPATH={build_dir} {interpreter} ./tabix_test.py '
+# endif
+
+# override_dh_install-indep:
+# dh_install -p $(TESTPKG)
+# cd debian/$(TESTPKG)/usr/share/doc/python-pysam/tests; \
+# make clean; \
+# rm -f log.txt ; \
+# chmod a+x tabix_test.py
+
--- /dev/null
+3.0 (quilt)
--- /dev/null
+Tests: run-unit-test
+Depends: @, python-pysam-tests, samtools, make
+Restrictions: allow-stderr
--- /dev/null
+#!/bin/sh -e
+
+if [ "$ADTTMP" = "" ] ; then
+ ADTTMP=`mktemp -d /tmp/python-pysam-test.XXXXXX`
+fi
+cd $ADTTMP
+cp -a /usr/share/doc/python-pysam/tests/* $ADTTMP
+gunzip -r *.py.gz \
+ ex9_fail.bam.gz \
+ ex9_nofail.bam.gz \
+ example_empty_header.bam.gz \
+ issue100.bam.gz
+chmod u+x ./pysam_test_offline.py
+./pysam_test_offline.py
--- /dev/null
+version=3
+
+https://pypi.python.org/packages/source/p/pysam/pysam-(\d+.*)\.tar\.gz